Incidental Mutation 'R4240:Mcm4'
ID320189
Institutional Source Beutler Lab
Gene Symbol Mcm4
Ensembl Gene ENSMUSG00000022673
Gene Nameminichromosome maintenance complex component 4
SynonymsmCdc21, 19G, Cdc21, Mcmd4
MMRRC Submission 041057-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4240 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location15623897-15637400 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 15627706 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 692 (Y692*)
Ref Sequence ENSEMBL: ENSMUSP00000023353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023353]
Predicted Effect probably null
Transcript: ENSMUST00000023353
AA Change: Y692*
SMART Domains Protein: ENSMUSP00000023353
Gene: ENSMUSG00000022673
AA Change: Y692*

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
MCM 266 769 N/A SMART
AAA 501 653 7.04e-3 SMART
Blast:MCM 781 849 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000229606
Predicted Effect probably benign
Transcript: ENSMUST00000230437
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this allele cause chromosomal instability as assessed by micronucleus levels in erythrocytes. Mice homozygous for a spontaneous allele exhibit early onset T cell acute lymphoblastic leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,591 I262V possibly damaging Het
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930488N24Rik A T 17: 14,105,787 noncoding transcript Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Ceacam3 G A 7: 17,160,024 E487K possibly damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cnot6l T C 5: 96,077,362 T491A probably benign Het
Cog7 C T 7: 121,925,484 V696M possibly damaging Het
Col22a1 C T 15: 72,007,131 G59D probably damaging Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Eno1b T A 18: 48,047,840 S362T probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam170a A T 18: 50,281,667 M127L possibly damaging Het
Gm17677 T A 9: 35,742,153 Y84* probably null Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Hsf4 A G 8: 105,274,881 T378A possibly damaging Het
Irf2bpl C A 12: 86,882,917 Q327H possibly damaging Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Kmt2d G A 15: 98,844,571 probably benign Het
Lad1 T A 1: 135,827,295 V103D possibly damaging Het
Med15 C T 16: 17,655,494 R497H probably damaging Het
Mfrp T C 9: 44,102,866 V177A possibly damaging Het
Mr1 T C 1: 155,136,667 E167G probably damaging Het
Myo18b A G 5: 112,803,187 probably null Het
Myom2 A G 8: 15,132,895 D1444G probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Nlrp4d A T 7: 10,381,316 H479Q noncoding transcript Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Rdh7 T C 10: 127,885,802 I202V probably benign Het
Rsf1 C CGGCGGCGGT 7: 97,579,935 probably benign Het
Sgsm3 A G 15: 81,011,782 probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc8a3 T C 12: 81,315,176 K290E probably damaging Het
Tbc1d17 T C 7: 44,846,826 Y84C probably damaging Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Vmn2r8 A T 5: 108,797,503 V746D probably damaging Het
Xdh A G 17: 73,895,795 V1120A possibly damaging Het
Zbtb38 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 9: 96,686,102 probably benign Het
Zfp791 T C 8: 85,109,666 H523R probably null Het
Zfp870 A G 17: 32,885,736 I53T probably benign Het
Other mutations in Mcm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Mcm4 APN 16 15626131 missense probably damaging 1.00
IGL01982:Mcm4 APN 16 15630420 missense possibly damaging 0.57
IGL02382:Mcm4 APN 16 15624738 missense probably damaging 1.00
PIT4687001:Mcm4 UTSW 16 15636713 missense probably benign 0.01
R0200:Mcm4 UTSW 16 15629639 missense probably benign 0.41
R0540:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R0607:Mcm4 UTSW 16 15632115 critical splice donor site probably null
R2064:Mcm4 UTSW 16 15634469 missense possibly damaging 0.75
R4604:Mcm4 UTSW 16 15629663 missense probably damaging 1.00
R4871:Mcm4 UTSW 16 15634510 nonsense probably null
R5070:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R5125:Mcm4 UTSW 16 15635303 missense probably benign 0.21
R5178:Mcm4 UTSW 16 15635303 missense probably benign 0.21
R5245:Mcm4 UTSW 16 15630425 missense probably benign 0.02
R5513:Mcm4 UTSW 16 15630514 missense probably benign 0.26
R5696:Mcm4 UTSW 16 15625570 missense probably damaging 1.00
R6453:Mcm4 UTSW 16 15630409 missense probably damaging 1.00
R6753:Mcm4 UTSW 16 15629362 missense possibly damaging 0.91
R6909:Mcm4 UTSW 16 15628697 missense probably damaging 1.00
R6937:Mcm4 UTSW 16 15636335 missense probably benign
R7402:Mcm4 UTSW 16 15637178 start codon destroyed probably null
R7483:Mcm4 UTSW 16 15630442 missense probably benign 0.05
R8275:Mcm4 UTSW 16 15634571 missense probably damaging 0.98
Z1177:Mcm4 UTSW 16 15629454 missense probably damaging 1.00
Z1177:Mcm4 UTSW 16 15632216 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GTGGGAATCTAAATATCACCCATCT -3'
(R):5'- AGTGTCTCAACTAAGAAGATGGTAT -3'

Sequencing Primer
(F):5'- GCATAGAGGATAGCTATCTTCCCAG -3'
(R):5'- AGAAGATGGTATTTTTCTCTTGTCAG -3'
Posted On2015-06-12