Incidental Mutation 'R4241:Blcap'
ID320202
Institutional Source Beutler Lab
Gene Symbol Blcap
Ensembl Gene ENSMUSG00000067787
Gene Namebladder cancer associated protein
SynonymsBc10
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R4241 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157556362-157571274 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 157560423 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088484] [ENSMUST00000088494] [ENSMUST00000109526] [ENSMUST00000109528] [ENSMUST00000153739] [ENSMUST00000172487] [ENSMUST00000173041] [ENSMUST00000173378] [ENSMUST00000173595] [ENSMUST00000173793] [ENSMUST00000173839]
Predicted Effect probably benign
Transcript: ENSMUST00000088484
SMART Domains Protein: ENSMUSP00000085836
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
low complexity region 71 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088494
SMART Domains Protein: ENSMUSP00000085849
Gene: ENSMUSG00000067787

DomainStartEndE-ValueType
Pfam:BC10 1 65 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104797
Predicted Effect probably benign
Transcript: ENSMUST00000109526
SMART Domains Protein: ENSMUSP00000105152
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109528
SMART Domains Protein: ENSMUSP00000105154
Gene: ENSMUSG00000067787

DomainStartEndE-ValueType
Pfam:BC10 1 65 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152605
Predicted Effect probably benign
Transcript: ENSMUST00000153739
SMART Domains Protein: ENSMUSP00000129821
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172487
SMART Domains Protein: ENSMUSP00000134415
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173041
SMART Domains Protein: ENSMUSP00000134109
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173378
Predicted Effect probably benign
Transcript: ENSMUST00000173595
SMART Domains Protein: ENSMUSP00000133397
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 67 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173793
SMART Domains Protein: ENSMUSP00000133487
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173839
SMART Domains Protein: ENSMUSP00000133394
Gene: ENSMUSG00000067786

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that reduces cell growth by stimulating apoptosis. Alternative splicing and the use of alternative promoters result in multiple transcript variants encoding the same protein. This gene is imprinted in brain where different transcript variants are expressed from each parental allele. Transcript variants initiating from the upstream promoter are expressed preferentially from the maternal allele, while transcript variants initiating downstream of the interspersed NNAT gene (GeneID:4826) are expressed from the paternal allele. Transcripts at this locus may also undergo A to I editing, resulting in amino acid changes at three positions in the N-terminus of the protein. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Bcas3 T A 11: 85,470,826 S25R probably damaging Het
Btbd6 C T 12: 112,976,796 A13V probably benign Het
Ccdc83 A C 7: 90,247,138 N74K probably damaging Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Coq6 A T 12: 84,373,789 probably benign Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Slc10a5 A G 3: 10,335,460 S47P probably damaging Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Tcerg1l G T 7: 138,397,632 Q8K unknown Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Blcap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0270:Blcap UTSW 2 157557977 nonsense probably null
R4242:Blcap UTSW 2 157560423 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCATCATCGGCTGGTACATC -3'
(R):5'- CTGTTGTGCGAACTGTAAAGTTTC -3'

Sequencing Primer
(F):5'- ATCGGCTGGTACATCTTCCG -3'
(R):5'- GTGCGAACTGTAAAGTTTCACAGC -3'
Posted On2015-06-12