Incidental Mutation 'R4241:Slc10a5'
ID320203
Institutional Source Beutler Lab
Gene Symbol Slc10a5
Ensembl Gene ENSMUSG00000058921
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 5
SynonymsLOC241877
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R4241 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location10331734-10335656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10335460 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 47 (S47P)
Ref Sequence ENSEMBL: ENSMUSP00000077808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037839] [ENSMUST00000065938] [ENSMUST00000078748] [ENSMUST00000118410] [ENSMUST00000128912] [ENSMUST00000191670] [ENSMUST00000192603]
Predicted Effect probably benign
Transcript: ENSMUST00000037839
SMART Domains Protein: ENSMUSP00000037459
Gene: ENSMUSG00000039795

DomainStartEndE-ValueType
ZnF_AN1 10 49 1.4e-8 SMART
ZnF_AN1 64 103 2.64e-4 SMART
low complexity region 121 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065938
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078748
AA Change: S47P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077808
Gene: ENSMUSG00000058921
AA Change: S47P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SBF 144 328 1.1e-34 PFAM
transmembrane domain 336 358 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118410
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125734
Predicted Effect probably benign
Transcript: ENSMUST00000128912
SMART Domains Protein: ENSMUSP00000116088
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 19 90 4.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191670
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192603
AA Change: S47P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141735
Gene: ENSMUSG00000103392
AA Change: S47P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Meta Mutation Damage Score 0.2455 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Bcas3 T A 11: 85,470,826 S25R probably damaging Het
Blcap T A 2: 157,560,423 probably benign Het
Btbd6 C T 12: 112,976,796 A13V probably benign Het
Ccdc83 A C 7: 90,247,138 N74K probably damaging Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Coq6 A T 12: 84,373,789 probably benign Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Tcerg1l G T 7: 138,397,632 Q8K unknown Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Slc10a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Slc10a5 APN 3 10335309 missense probably benign 0.05
IGL01785:Slc10a5 APN 3 10335199 missense probably benign 0.00
IGL01823:Slc10a5 APN 3 10334514 missense possibly damaging 0.93
IGL01915:Slc10a5 APN 3 10335520 missense probably damaging 0.98
IGL02522:Slc10a5 APN 3 10335121 missense probably benign 0.09
IGL02721:Slc10a5 APN 3 10334535 missense probably benign 0.01
PIT4382001:Slc10a5 UTSW 3 10335447 missense probably benign
R0558:Slc10a5 UTSW 3 10335117 missense probably damaging 1.00
R0961:Slc10a5 UTSW 3 10334424 missense probably benign 0.00
R1747:Slc10a5 UTSW 3 10335391 missense probably benign 0.04
R1889:Slc10a5 UTSW 3 10335490 missense probably benign 0.33
R2130:Slc10a5 UTSW 3 10335218 missense probably benign
R2171:Slc10a5 UTSW 3 10335282 missense possibly damaging 0.59
R2970:Slc10a5 UTSW 3 10335067 missense probably damaging 1.00
R2972:Slc10a5 UTSW 3 10334457 missense probably damaging 0.98
R2973:Slc10a5 UTSW 3 10334457 missense probably damaging 0.98
R4700:Slc10a5 UTSW 3 10335299 missense probably damaging 1.00
R4700:Slc10a5 UTSW 3 10335300 missense probably damaging 1.00
R4790:Slc10a5 UTSW 3 10335036 missense probably damaging 1.00
R4834:Slc10a5 UTSW 3 10334799 missense probably damaging 0.97
R4891:Slc10a5 UTSW 3 10334625 missense possibly damaging 0.79
R5220:Slc10a5 UTSW 3 10335088 nonsense probably null
R5548:Slc10a5 UTSW 3 10334317 missense probably benign
R5748:Slc10a5 UTSW 3 10335331 missense probably benign 0.00
R6573:Slc10a5 UTSW 3 10335050 missense probably damaging 1.00
R6909:Slc10a5 UTSW 3 10335595 missense possibly damaging 0.90
R7355:Slc10a5 UTSW 3 10334315 nonsense probably null
R7807:Slc10a5 UTSW 3 10335469 missense probably benign 0.00
R7866:Slc10a5 UTSW 3 10334472 missense probably damaging 0.99
R8219:Slc10a5 UTSW 3 10335324 missense probably benign 0.32
Z1176:Slc10a5 UTSW 3 10334487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCCGTCTGTCTGAACAC -3'
(R):5'- GGGTAGGCACACATGGTTTG -3'

Sequencing Primer
(F):5'- ACATTCTTTAGCTCGTCGATGAG -3'
(R):5'- GGTAGGCACACATGGTTTGTTTAAAC -3'
Posted On2015-06-12