Mutagenetix > Incidental Mutations

Incidental Mutation 'R4241:Sprr3'

320205

Institutional Source

Beutler Lab

Gene Symbol

Sprr3

Ensembl Gene

ENSMUSG00000045539

Gene Name

small proline-rich protein 3

Synonyms

SPR3

MMRRC Submission

041058-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4241 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92456502-92458720 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92456907 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 210 (V210A)

Ref Sequence

ENSEMBL: ENSMUSP00000056287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058142]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058142
AA Change: V210A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000056287
Gene: ENSMUSG00000045539
AA Change: V210A

Domain	Start	End	E-Value	Type
Pfam:Cornifin	17	142	1.3e-35	PFAM
Pfam:Cornifin	125	236	3.9e-26	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (49/50)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,154,335	S1575G	probably damaging	Het
Agl	A	T	3: 116,754,848		probably benign	Het
Ap5b1	C	T	19: 5,568,797	L82F	possibly damaging	Het
Arfgef3	A	G	10: 18,625,164	S1113P	probably damaging	Het
Atoh1	A	C	6: 64,729,774	N151T	probably damaging	Het
Bcas3	T	A	11: 85,470,826	S25R	probably damaging	Het
Blcap	T	A	2: 157,560,423		probably benign	Het
Btbd6	C	T	12: 112,976,796	A13V	probably benign	Het
Ccdc83	A	C	7: 90,247,138	N74K	probably damaging	Het
Cdh9	A	G	15: 16,849,079		probably null	Het
Chd1	C	T	17: 15,770,027	R1614*	probably null	Het
Col16a1	G	T	4: 130,099,050	Q1567H	probably damaging	Het
Coq6	A	T	12: 84,373,789		probably benign	Het
Cpd	T	C	11: 76,846,785	D61G	probably benign	Het
Csnk1e	A	G	15: 79,424,895	F277S	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,779,586		noncoding transcript	Het
Dbt	T	C	3: 116,533,296	I98T	probably damaging	Het
Eif3e	G	A	15: 43,262,690	T287I	probably damaging	Het
Gm7135	A	G	1: 97,353,953		noncoding transcript	Het
Gpr176	A	T	2: 118,279,610	S389R	probably benign	Het
Hax1	A	G	3: 89,995,690	S257P	probably damaging	Het
Herc1	CTGAGGACTCTTTG	CTG	9: 66,448,348		probably null	Het
Ighv1-53	C	T	12: 115,158,822	C5Y	probably benign	Het
Klhl13	T	A	X: 23,315,175	D2V	probably damaging	Het
Kynu	A	T	2: 43,681,410	H446L	probably benign	Het
Lingo1	A	G	9: 56,620,102	F401S	probably damaging	Het
Lmbrd1	C	T	1: 24,692,968	Q89*	probably null	Het
Mov10	T	A	3: 104,797,276	Q773L	probably benign	Het
Olfr1356	T	A	10: 78,847,905	R3S	probably benign	Het
Olfr596	G	T	7: 103,310,661	*313Y	probably null	Het
Pde6c	G	A	19: 38,162,845	G608S	probably damaging	Het
Peli3	T	C	19: 4,932,398	H413R	probably damaging	Het
Pkdrej	C	T	15: 85,818,144	R1197Q	probably damaging	Het
Rcan2	T	A	17: 43,953,479	V10D	probably benign	Het
Slc10a5	A	G	3: 10,335,460	S47P	probably damaging	Het
Tcerg1l	G	T	7: 138,397,632	Q8K	unknown	Het
Ubfd1	T	C	7: 122,071,754	V265A	possibly damaging	Het
Ubr1	T	C	2: 120,934,386	D529G	possibly damaging	Het
Vmn1r180	A	T	7: 23,952,873	I154F	probably damaging	Het
Vmn1r237	A	G	17: 21,314,663	H216R	possibly damaging	Het
Whrn	C	T	4: 63,432,973		probably benign	Het
Zfr	T	G	15: 12,149,659	D388E	probably damaging	Het
Zic5	T	C	14: 122,464,663	I219V	probably benign	Het
Zmat5	A	G	11: 4,728,614	N53D	probably benign	Het

Other mutations in Sprr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02557:Sprr3	APN	3	92457166	missense	possibly damaging	0.95
BB010:Sprr3	UTSW	3	92457208	missense	possibly damaging	0.66
BB020:Sprr3	UTSW	3	92457208	missense	possibly damaging	0.66
R0070:Sprr3	UTSW	3	92457302	missense	probably benign
R0512:Sprr3	UTSW	3	92457477	missense	possibly damaging	0.71
R0907:Sprr3	UTSW	3	92457009	missense	probably benign	0.09
R1976:Sprr3	UTSW	3	92456946	missense	possibly damaging	0.52
R4503:Sprr3	UTSW	3	92457376	missense	possibly damaging	0.51
R7622:Sprr3	UTSW	3	92457285	missense	probably damaging	0.98
R7753:Sprr3	UTSW	3	92457108	missense	probably benign	0.18
R7933:Sprr3	UTSW	3	92457208	missense	possibly damaging	0.66
R8061:Sprr3	UTSW	3	92456877	missense	probably damaging	0.98
R8742:Sprr3	UTSW	3	92457000	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GTCTCTAGACAATGGGGACAC -3'
(R):5'- GCCAGATTATACCACAATTCCTGG -3'

Sequencing Primer
(F):5'- CAGAGCTTACAGGAAAGACTTCAGC -3'
(R):5'- GATTATACCACAATTCCTGGGCCATC -3'

Posted On

2015-06-12