Mutagenetix > Incidental Mutations

Incidental Mutation 'R4241:Dbt'

320206

Institutional Source

Beutler Lab

Gene Symbol

Dbt

Ensembl Gene

ENSMUSG00000000340

Gene Name

dihydrolipoamide branched chain transacylase E2

Synonyms

D3Wsu60e, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, dihydrolipoyl transacylase, BCKAD E2

MMRRC Submission

041058-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4241 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116513070-116549981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116533296 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 98 (I98T)

Ref Sequence

ENSEMBL: ENSMUSP00000000349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000349] [ENSMUST00000197201] [ENSMUST00000199614]

Predicted Effect

probably damaging
Transcript: ENSMUST00000000349
AA Change: I98T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000349
Gene: ENSMUSG00000000340
AA Change: I98T

Domain	Start	End	E-Value	Type
Pfam:Biotin_lipoyl	65	138	2.8e-22	PFAM
Pfam:E3_binding	171	206	4.4e-18	PFAM
low complexity region	218	232	N/A	INTRINSIC
Pfam:2-oxoacid_dh	248	479	8.5e-83	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000117197

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196376

Predicted Effect

probably benign
Transcript: ENSMUST00000197201

Predicted Effect

probably benign
Transcript: ENSMUST00000199614

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199796

Meta Mutation Damage Score

0.8052

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid dehydrogenase complex (BCKD) is an inner-mitochondrial enzyme complex involved in the breakdown of the branched-chain amino acids isoleucine, leucine, and valine. The BCKD complex is thought to be composed of a core of 24 transacylase (E2) subunits, and associated decarboxylase (E1), dehydrogenase (E3), and regulatory subunits. This gene encodes the transacylase (E2) subunit. Mutations in this gene result in maple syrup urine disease, type 2. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, pallor, respiratory distress, and an increase in branched-chain amino acids in the blood and urine. Homozygotes model Maple Syrup Urine Disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,154,335	S1575G	probably damaging	Het
Agl	A	T	3: 116,754,848		probably benign	Het
Ap5b1	C	T	19: 5,568,797	L82F	possibly damaging	Het
Arfgef3	A	G	10: 18,625,164	S1113P	probably damaging	Het
Atoh1	A	C	6: 64,729,774	N151T	probably damaging	Het
Bcas3	T	A	11: 85,470,826	S25R	probably damaging	Het
Blcap	T	A	2: 157,560,423		probably benign	Het
Btbd6	C	T	12: 112,976,796	A13V	probably benign	Het
Ccdc83	A	C	7: 90,247,138	N74K	probably damaging	Het
Cdh9	A	G	15: 16,849,079		probably null	Het
Chd1	C	T	17: 15,770,027	R1614*	probably null	Het
Col16a1	G	T	4: 130,099,050	Q1567H	probably damaging	Het
Coq6	A	T	12: 84,373,789		probably benign	Het
Cpd	T	C	11: 76,846,785	D61G	probably benign	Het
Csnk1e	A	G	15: 79,424,895	F277S	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,779,586		noncoding transcript	Het
Eif3e	G	A	15: 43,262,690	T287I	probably damaging	Het
Gm7135	A	G	1: 97,353,953		noncoding transcript	Het
Gpr176	A	T	2: 118,279,610	S389R	probably benign	Het
Hax1	A	G	3: 89,995,690	S257P	probably damaging	Het
Herc1	CTGAGGACTCTTTG	CTG	9: 66,448,348		probably null	Het
Ighv1-53	C	T	12: 115,158,822	C5Y	probably benign	Het
Klhl13	T	A	X: 23,315,175	D2V	probably damaging	Het
Kynu	A	T	2: 43,681,410	H446L	probably benign	Het
Lingo1	A	G	9: 56,620,102	F401S	probably damaging	Het
Lmbrd1	C	T	1: 24,692,968	Q89*	probably null	Het
Mov10	T	A	3: 104,797,276	Q773L	probably benign	Het
Olfr1356	T	A	10: 78,847,905	R3S	probably benign	Het
Olfr596	G	T	7: 103,310,661	*313Y	probably null	Het
Pde6c	G	A	19: 38,162,845	G608S	probably damaging	Het
Peli3	T	C	19: 4,932,398	H413R	probably damaging	Het
Pkdrej	C	T	15: 85,818,144	R1197Q	probably damaging	Het
Rcan2	T	A	17: 43,953,479	V10D	probably benign	Het
Slc10a5	A	G	3: 10,335,460	S47P	probably damaging	Het
Sprr3	A	G	3: 92,456,907	V210A	possibly damaging	Het
Tcerg1l	G	T	7: 138,397,632	Q8K	unknown	Het
Ubfd1	T	C	7: 122,071,754	V265A	possibly damaging	Het
Ubr1	T	C	2: 120,934,386	D529G	possibly damaging	Het
Vmn1r180	A	T	7: 23,952,873	I154F	probably damaging	Het
Vmn1r237	A	G	17: 21,314,663	H216R	possibly damaging	Het
Whrn	C	T	4: 63,432,973		probably benign	Het
Zfr	T	G	15: 12,149,659	D388E	probably damaging	Het
Zic5	T	C	14: 122,464,663	I219V	probably benign	Het
Zmat5	A	G	11: 4,728,614	N53D	probably benign	Het

Other mutations in Dbt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Dbt	APN	3	116539281	missense	probably benign
IGL00660:Dbt	APN	3	116546295	missense	probably damaging	1.00
IGL00839:Dbt	APN	3	116546114	missense	probably benign	0.21
IGL00840:Dbt	APN	3	116546114	missense	probably benign	0.21
IGL00841:Dbt	APN	3	116546114	missense	probably benign	0.21
IGL00852:Dbt	APN	3	116546114	missense	probably benign	0.21
IGL00861:Dbt	APN	3	116546114	missense	probably benign	0.21
IGL00955:Dbt	APN	3	116546114	missense	probably benign	0.21
IGL00956:Dbt	APN	3	116546114	missense	probably benign	0.21
IGL01475:Dbt	APN	3	116520259	missense	possibly damaging	0.92
IGL01521:Dbt	APN	3	116533383	missense	probably benign	0.00
IGL01806:Dbt	APN	3	116533305	missense	probably damaging	1.00
IGL03288:Dbt	APN	3	116548198	makesense	probably null
R0025:Dbt	UTSW	3	116534783	missense	probably benign	0.22
R0066:Dbt	UTSW	3	116543829	missense	probably benign	0.00
R0066:Dbt	UTSW	3	116543829	missense	probably benign	0.00
R0190:Dbt	UTSW	3	116539087	critical splice acceptor site	probably null
R1650:Dbt	UTSW	3	116534732	splice site	probably null
R1750:Dbt	UTSW	3	116546294	missense	probably benign	0.18
R2130:Dbt	UTSW	3	116539124	missense	probably damaging	1.00
R2131:Dbt	UTSW	3	116539124	missense	probably damaging	1.00
R2133:Dbt	UTSW	3	116539124	missense	probably damaging	1.00
R2897:Dbt	UTSW	3	116523412	missense	probably damaging	1.00
R3442:Dbt	UTSW	3	116548191	missense	probably benign
R4681:Dbt	UTSW	3	116533314	missense	probably damaging	1.00
R4724:Dbt	UTSW	3	116533296	missense	probably damaging	1.00
R4736:Dbt	UTSW	3	116539132	missense	probably damaging	0.99
R4737:Dbt	UTSW	3	116539132	missense	probably damaging	0.99
R4738:Dbt	UTSW	3	116539132	missense	probably damaging	0.99
R4740:Dbt	UTSW	3	116539132	missense	probably damaging	0.99
R4809:Dbt	UTSW	3	116546343	missense	probably damaging	1.00
R4823:Dbt	UTSW	3	116523387	missense	probably damaging	1.00
R4861:Dbt	UTSW	3	116548078	missense	probably benign	0.00
R4861:Dbt	UTSW	3	116548078	missense	probably benign	0.00
R5148:Dbt	UTSW	3	116528244	intron	probably benign
R5327:Dbt	UTSW	3	116528571	intron	probably benign
R5700:Dbt	UTSW	3	116520303	missense	probably damaging	0.97
R5931:Dbt	UTSW	3	116523425	missense	possibly damaging	0.80
R6463:Dbt	UTSW	3	116539760	missense	possibly damaging	0.51
R7841:Dbt	UTSW	3	116546097	missense	possibly damaging	0.85
R7924:Dbt	UTSW	3	116546097	missense	possibly damaging	0.85
RF008:Dbt	UTSW	3	116548068	nonsense	probably null
RF016:Dbt	UTSW	3	116539714	missense	probably damaging	1.00
Z1177:Dbt	UTSW	3	116546091	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCATTTGGGCGTCAATACTG -3'
(R):5'- CCTCAACCCAGATTTCATAACTTAG -3'

Sequencing Primer
(F):5'- GTCAATACTGCACTAGATGGCTCG -3'
(R):5'- CAGATTTCTGAGTTCCAGGACAGC -3'

Posted On

2015-06-12