Incidental Mutation 'R4241:Ccdc83'
ID320214
Institutional Source Beutler Lab
Gene Symbol Ccdc83
Ensembl Gene ENSMUSG00000030617
Gene Namecoiled-coil domain containing 83
Synonyms4930549K11Rik, 4930554C01Rik, 4932423M01Rik
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4241 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90223873-90265777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90247138 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 74 (N74K)
Ref Sequence ENSEMBL: ENSMUSP00000047758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040413] [ENSMUST00000107220] [ENSMUST00000107221]
Predicted Effect probably damaging
Transcript: ENSMUST00000040413
AA Change: N74K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047758
Gene: ENSMUSG00000030617
AA Change: N74K

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107220
AA Change: N74K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102838
Gene: ENSMUSG00000030617
AA Change: N74K

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107221
AA Change: N74K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102839
Gene: ENSMUSG00000030617
AA Change: N74K

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Blast:BROMO 202 232 1e-5 BLAST
low complexity region 241 249 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Bcas3 T A 11: 85,470,826 S25R probably damaging Het
Blcap T A 2: 157,560,423 probably benign Het
Btbd6 C T 12: 112,976,796 A13V probably benign Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Coq6 A T 12: 84,373,789 probably benign Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Slc10a5 A G 3: 10,335,460 S47P probably damaging Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Tcerg1l G T 7: 138,397,632 Q8K unknown Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Ccdc83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ccdc83 APN 7 90244044 missense probably damaging 1.00
IGL01092:Ccdc83 APN 7 90247105 missense probably benign 0.11
IGL01394:Ccdc83 APN 7 90224001 missense probably damaging 1.00
IGL02585:Ccdc83 APN 7 90236912 missense probably damaging 1.00
IGL02631:Ccdc83 APN 7 90244069 missense possibly damaging 0.76
PIT4354001:Ccdc83 UTSW 7 90223974 missense probably benign 0.21
R0189:Ccdc83 UTSW 7 90226683 missense possibly damaging 0.94
R0538:Ccdc83 UTSW 7 90228383 missense probably damaging 0.99
R1441:Ccdc83 UTSW 7 90244143 missense probably damaging 1.00
R1478:Ccdc83 UTSW 7 90259469 missense probably damaging 0.99
R1781:Ccdc83 UTSW 7 90250541 missense probably damaging 1.00
R1929:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R1969:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1970:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1971:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R2008:Ccdc83 UTSW 7 90244141 missense probably damaging 1.00
R2220:Ccdc83 UTSW 7 90259514 missense probably damaging 0.96
R2271:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R2426:Ccdc83 UTSW 7 90228431 missense probably damaging 1.00
R2985:Ccdc83 UTSW 7 90236367 intron probably benign
R3712:Ccdc83 UTSW 7 90236355 intron probably benign
R4260:Ccdc83 UTSW 7 90228391 missense possibly damaging 0.86
R4374:Ccdc83 UTSW 7 90226778 nonsense probably null
R5071:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5072:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5074:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5749:Ccdc83 UTSW 7 90223948 missense probably damaging 1.00
R5929:Ccdc83 UTSW 7 90236316 intron probably benign
R6283:Ccdc83 UTSW 7 90236407 nonsense probably null
R6574:Ccdc83 UTSW 7 90226677 missense possibly damaging 0.69
R6725:Ccdc83 UTSW 7 90247053 missense probably damaging 1.00
R7320:Ccdc83 UTSW 7 90224034 missense probably damaging 1.00
R7485:Ccdc83 UTSW 7 90223930 missense probably benign 0.17
R7511:Ccdc83 UTSW 7 90236922 missense possibly damaging 0.69
R7750:Ccdc83 UTSW 7 90223982 nonsense probably null
R7773:Ccdc83 UTSW 7 90229912 missense probably damaging 1.00
R7950:Ccdc83 UTSW 7 90229787 splice site probably null
X0067:Ccdc83 UTSW 7 90247155 missense possibly damaging 0.94
Z1088:Ccdc83 UTSW 7 90244046 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAGAGTCATGCATTGGAAGGC -3'
(R):5'- TCTATTGATGGCTACTGCACTG -3'

Sequencing Primer
(F):5'- CATTGGAAGGCAAAGGCAGTAACTC -3'
(R):5'- ATGGCTACTGCACTGATTTTATTTTG -3'
Posted On2015-06-12