Incidental Mutation 'R4241:Bcas3'
ID320223
Institutional Source Beutler Lab
Gene Symbol Bcas3
Ensembl Gene ENSMUSG00000059439
Gene Namebreast carcinoma amplified sequence 3
Synonyms2610028P08Rik, 1500019F07Rik, rudhira, K20D4
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R4241 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location85353167-85826058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85470826 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 25 (S25R)
Ref Sequence ENSEMBL: ENSMUSP00000114415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074875] [ENSMUST00000092821] [ENSMUST00000108056] [ENSMUST00000108061] [ENSMUST00000108062] [ENSMUST00000144276]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074875
AA Change: S271R

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074416
Gene: ENSMUSG00000059439
AA Change: S271R

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 792 2.3e-33 PFAM
low complexity region 885 901 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092821
AA Change: S271R

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090496
Gene: ENSMUSG00000059439
AA Change: S271R

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 776 3.8e-35 PFAM
low complexity region 870 886 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108056
AA Change: S271R

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103691
Gene: ENSMUSG00000059439
AA Change: S271R

DomainStartEndE-ValueType
Blast:WD40 56 104 7e-18 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108061
AA Change: S271R

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103696
Gene: ENSMUSG00000059439
AA Change: S271R

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 789 1e-33 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108062
AA Change: S271R

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103697
Gene: ENSMUSG00000059439
AA Change: S271R

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 796 1.3e-28 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144276
AA Change: S25R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114415
Gene: ENSMUSG00000059439
AA Change: S25R

DomainStartEndE-ValueType
WD40 94 134 7.7e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000154396
AA Change: S50R
SMART Domains Protein: ENSMUSP00000122154
Gene: ENSMUSG00000059439
AA Change: S50R

DomainStartEndE-ValueType
WD40 120 160 7.7e-1 SMART
WD40 170 213 2.47e1 SMART
low complexity region 260 274 N/A INTRINSIC
low complexity region 285 294 N/A INTRINSIC
Pfam:BCAS3 301 561 1e-30 PFAM
low complexity region 650 666 N/A INTRINSIC
Meta Mutation Damage Score 0.1242 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Blcap T A 2: 157,560,423 probably benign Het
Btbd6 C T 12: 112,976,796 A13V probably benign Het
Ccdc83 A C 7: 90,247,138 N74K probably damaging Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Coq6 A T 12: 84,373,789 probably benign Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Slc10a5 A G 3: 10,335,460 S47P probably damaging Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Tcerg1l G T 7: 138,397,632 Q8K unknown Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Bcas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Bcas3 APN 11 85365591 missense probably damaging 0.98
IGL00754:Bcas3 APN 11 85495823 splice site probably benign
IGL01712:Bcas3 APN 11 85581048 missense probably damaging 0.99
IGL02073:Bcas3 APN 11 85557437 missense probably damaging 1.00
IGL02261:Bcas3 APN 11 85531930 missense probably damaging 1.00
IGL02323:Bcas3 APN 11 85495845 missense probably damaging 0.97
IGL02493:Bcas3 APN 11 85495882 missense probably damaging 0.99
IGL02609:Bcas3 APN 11 85457894 missense probably damaging 1.00
IGL02808:Bcas3 APN 11 85495851 missense probably benign 0.02
IGL03085:Bcas3 APN 11 85476783 missense probably damaging 1.00
IGL03263:Bcas3 APN 11 85822122 intron probably benign
FR4340:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4342:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4589:Bcas3 UTSW 11 85509497 missense probably benign 0.12
IGL02991:Bcas3 UTSW 11 85457887 nonsense probably null
PIT4377001:Bcas3 UTSW 11 85495842 missense probably damaging 0.98
PIT4472001:Bcas3 UTSW 11 85531900 missense probably damaging 0.99
R0145:Bcas3 UTSW 11 85359610 splice site probably benign
R0257:Bcas3 UTSW 11 85822039 missense probably benign 0.00
R0276:Bcas3 UTSW 11 85470837 critical splice donor site probably null
R0485:Bcas3 UTSW 11 85495850 missense probably damaging 0.99
R1053:Bcas3 UTSW 11 85557410 missense probably benign 0.10
R1833:Bcas3 UTSW 11 85583949 missense probably benign 0.00
R2107:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2108:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2215:Bcas3 UTSW 11 85801943 missense probably damaging 0.99
R2404:Bcas3 UTSW 11 85354889 splice site probably benign
R2413:Bcas3 UTSW 11 85531855 missense probably damaging 1.00
R3694:Bcas3 UTSW 11 85801802 missense probably benign 0.00
R3880:Bcas3 UTSW 11 85371122 missense probably benign 0.02
R4794:Bcas3 UTSW 11 85509468 missense probably damaging 1.00
R5035:Bcas3 UTSW 11 85543945 missense probably damaging 1.00
R5073:Bcas3 UTSW 11 85371132 missense probably damaging 1.00
R5245:Bcas3 UTSW 11 85559086 missense probably damaging 1.00
R5358:Bcas3 UTSW 11 85451755 missense probably benign 0.02
R5395:Bcas3 UTSW 11 85825249 missense probably damaging 0.99
R5615:Bcas3 UTSW 11 85470761 missense probably damaging 1.00
R5753:Bcas3 UTSW 11 85822084 intron probably benign
R6198:Bcas3 UTSW 11 85509435 missense probably damaging 0.99
R6668:Bcas3 UTSW 11 85801851 missense probably damaging 0.98
R7170:Bcas3 UTSW 11 85495918 missense probably damaging 0.96
R7171:Bcas3 UTSW 11 85583937 missense probably damaging 1.00
R7672:Bcas3 UTSW 11 85395387 nonsense probably null
R7689:Bcas3 UTSW 11 85495887 missense probably benign 0.10
R7912:Bcas3 UTSW 11 85371128 missense probably damaging 1.00
R7993:Bcas3 UTSW 11 85371128 missense probably damaging 1.00
V3553:Bcas3 UTSW 11 85822100 intron probably benign
X0020:Bcas3 UTSW 11 85531808 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCCAGCGTCCTTATTATGC -3'
(R):5'- CTTGAATCCAGTTGCAATACACC -3'

Sequencing Primer
(F):5'- ATGCATGGTAAATAGCTGCTGTC -3'
(R):5'- ATGGAGTAAGTACAAACCATACAATC -3'
Posted On2015-06-12