Incidental Mutation 'R4241:Coq6'
ID320224
Institutional Source Beutler Lab
Gene Symbol Coq6
Ensembl Gene ENSMUSG00000021235
Gene Namecoenzyme Q6 monooxygenase
Synonyms5930427M12Rik
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4241 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84361657-84373796 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 84373789 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021661] [ENSMUST00000021662] [ENSMUST00000072061] [ENSMUST00000110272] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000117286] [ENSMUST00000120942] [ENSMUST00000122194] [ENSMUST00000152913]
Predicted Effect probably benign
Transcript: ENSMUST00000021661
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021662
SMART Domains Protein: ENSMUSP00000021662
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072061
SMART Domains Protein: ENSMUSP00000071939
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
transmembrane domain 27 46 N/A INTRINSIC
Pfam:GDA1_CD39 65 451 1.9e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110272
SMART Domains Protein: ENSMUSP00000105901
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110276
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110278
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117286
SMART Domains Protein: ENSMUSP00000114011
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120942
SMART Domains Protein: ENSMUSP00000112516
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122194
SMART Domains Protein: ENSMUSP00000113106
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140961
Predicted Effect probably benign
Transcript: ENSMUST00000145522
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150391
Predicted Effect probably benign
Transcript: ENSMUST00000152913
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156592
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Bcas3 T A 11: 85,470,826 S25R probably damaging Het
Blcap T A 2: 157,560,423 probably benign Het
Btbd6 C T 12: 112,976,796 A13V probably benign Het
Ccdc83 A C 7: 90,247,138 N74K probably damaging Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Slc10a5 A G 3: 10,335,460 S47P probably damaging Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Tcerg1l G T 7: 138,397,632 Q8K unknown Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Coq6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0508:Coq6 UTSW 12 84368139 splice site probably benign
R0607:Coq6 UTSW 12 84368638 missense possibly damaging 0.95
R1221:Coq6 UTSW 12 84371527 missense possibly damaging 0.96
R1885:Coq6 UTSW 12 84372464 missense probably damaging 1.00
R1898:Coq6 UTSW 12 84366963 missense probably benign 0.38
R3153:Coq6 UTSW 12 84371535 missense probably damaging 1.00
R3824:Coq6 UTSW 12 84372415 splice site probably benign
R4015:Coq6 UTSW 12 84366897 missense probably benign 0.00
R4285:Coq6 UTSW 12 84370404 intron probably benign
R4353:Coq6 UTSW 12 84368149 missense probably damaging 0.99
R4598:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4599:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4868:Coq6 UTSW 12 84370952 missense probably damaging 0.99
R4887:Coq6 UTSW 12 84372296 missense probably damaging 1.00
R5567:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5570:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5715:Coq6 UTSW 12 84366907 missense probably benign 0.10
R6608:Coq6 UTSW 12 84372148 missense probably benign 0.00
R7035:Coq6 UTSW 12 84368641 missense probably damaging 0.99
R7096:Coq6 UTSW 12 84361821 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGAAATAAGCAGGGCTC -3'
(R):5'- GTCTGTTGCCAAGTGAAGTG -3'

Sequencing Primer
(F):5'- GGCTGTTTCTTTATGAAGTCACC -3'
(R):5'- TGAGGGAGAACATCTTGGAGATTCC -3'
Posted On2015-06-12