Incidental Mutation 'R0396:Akna'
ID 32023
Institutional Source Beutler Lab
Gene Symbol Akna
Ensembl Gene ENSMUSG00000039158
Gene Name AT-hook transcription factor
Synonyms
MMRRC Submission 038602-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock # R0396 (G1)
Quality Score 222
Status Validated
Chromosome 4
Chromosomal Location 63367125-63403354 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 63392126 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035724]
AlphaFold Q80VW7
Predicted Effect probably benign
Transcript: ENSMUST00000035724
SMART Domains Protein: ENSMUSP00000041614
Gene: ENSMUSG00000039158

DomainStartEndE-ValueType
low complexity region 140 153 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
Pfam:AKNA 584 681 4.6e-37 PFAM
low complexity region 760 774 N/A INTRINSIC
low complexity region 1015 1029 N/A INTRINSIC
coiled coil region 1044 1066 N/A INTRINSIC
low complexity region 1296 1317 N/A INTRINSIC
low complexity region 1319 1343 N/A INTRINSIC
coiled coil region 1353 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144095
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic or a knock-out allele exhibit partial postnatal lethality, pathogen-induced acute neutrophil responses leading to systemic inflammation and alveolar destruction, and increased susceptibility to fungal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,377 V467A possibly damaging Het
4933405L10Rik G A 8: 105,709,780 V194I probably benign Het
Acsm1 A T 7: 119,636,455 I133F probably damaging Het
Adamts9 T A 6: 92,798,005 T1676S probably benign Het
Adcy4 T C 14: 55,772,288 D769G probably benign Het
Aif1 T C 17: 35,171,109 *148W probably null Het
Arhgap32 G A 9: 32,245,255 probably null Het
Atpaf1 G A 4: 115,785,252 E92K possibly damaging Het
C1s1 T C 6: 124,533,354 E378G probably benign Het
Caprin1 T A 2: 103,769,569 Q108L probably damaging Het
Car13 A T 3: 14,656,239 H154L probably benign Het
Cdon C A 9: 35,470,130 N605K probably damaging Het
Ceacam10 G A 7: 24,781,014 G70E probably damaging Het
Cfap221 G A 1: 119,954,200 T286M probably benign Het
Cfap61 T C 2: 145,949,944 F107S possibly damaging Het
Coil C A 11: 88,981,623 T270N probably benign Het
Crocc2 T G 1: 93,224,214 probably benign Het
Crot T C 5: 8,969,959 E461G probably damaging Het
D130052B06Rik G T 11: 33,623,391 R41L unknown Het
D630045J12Rik T C 6: 38,196,736 S166G possibly damaging Het
Dennd4a T G 9: 64,862,391 V460G probably damaging Het
Depdc7 A T 2: 104,727,323 probably benign Het
Dgkb G A 12: 38,190,135 probably null Het
Dhx57 T G 17: 80,274,797 S407R probably benign Het
Dnase2a G T 8: 84,909,763 probably benign Het
Dqx1 T G 6: 83,059,005 M106R probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Ephx2 T G 14: 66,108,063 I151L probably benign Het
Gdf3 C T 6: 122,607,135 G91D probably damaging Het
Gm14124 G A 2: 150,268,053 G221D probably damaging Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gsdme T A 6: 50,221,107 H291L probably benign Het
H2-Bl A G 17: 36,083,722 I103T possibly damaging Het
Hif3a G A 7: 17,052,021 probably benign Het
Hmox2 A T 16: 4,765,763 I232L probably benign Het
Itgb2 A G 10: 77,561,189 Y686C probably damaging Het
Jmjd1c A G 10: 67,219,523 T528A possibly damaging Het
Kdr T C 5: 75,960,728 I541V possibly damaging Het
Khdrbs2 C A 1: 32,519,973 V343L probably damaging Het
Kif16b C T 2: 142,853,659 R175H probably damaging Het
Klri2 T G 6: 129,740,288 E44A possibly damaging Het
Kmt2b G T 7: 30,576,755 T1773K probably damaging Het
Lair1 A G 7: 4,010,786 L154P probably damaging Het
Larp1b G A 3: 40,970,561 V158M probably damaging Het
Lgi3 T A 14: 70,534,840 I275N probably damaging Het
Lrba A G 3: 86,295,179 N246D probably damaging Het
Lrrc45 T A 11: 120,714,907 probably benign Het
Mdh2 G T 5: 135,789,679 V263L probably benign Het
Myom1 T A 17: 71,034,693 V149E probably damaging Het
Nanos1 A T 19: 60,757,041 D259V probably damaging Het
Nedd4l T A 18: 65,161,654 probably benign Het
Npas3 A G 12: 53,831,745 Y150C probably damaging Het
Olfr1066 T C 2: 86,456,019 N84S possibly damaging Het
Olfr1129 T A 2: 87,575,567 V161D possibly damaging Het
Olfr1392 A T 11: 49,293,338 I6F probably benign Het
Olfr479 A T 7: 108,055,963 H327L probably benign Het
Olfr672 G A 7: 104,996,706 A66V probably damaging Het
Olfr93 C T 17: 37,151,555 C139Y probably damaging Het
Pde4c A G 8: 70,750,076 N637S probably benign Het
Pds5b T A 5: 150,779,275 V824D possibly damaging Het
Pole2 A T 12: 69,222,386 probably benign Het
Ppig C T 2: 69,735,976 probably benign Het
Prep A G 10: 45,092,676 Y90C probably damaging Het
Proca1 A T 11: 78,194,905 R11S probably damaging Het
Prph T A 15: 99,056,991 W313R probably benign Het
Prune2 C T 19: 17,123,080 P1983S probably benign Het
Ptbp2 G A 3: 119,724,198 probably benign Het
Rsph6a C T 7: 19,074,106 P398L probably damaging Het
Sdk2 T C 11: 113,829,967 I1379V probably benign Het
Sf3b1 C T 1: 55,019,271 G53E probably damaging Het
Slc9a3 T C 13: 74,157,784 probably null Het
Smarcal1 A T 1: 72,626,473 H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,150,707 probably benign Het
Sptan1 T C 2: 29,991,033 V438A probably damaging Het
Sstr4 T A 2: 148,396,261 V264D probably damaging Het
Susd2 A G 10: 75,639,911 L418P probably damaging Het
Synj1 A G 16: 90,938,640 V1475A probably benign Het
Szt2 G A 4: 118,376,347 probably benign Het
Tbc1d4 T C 14: 101,458,063 probably null Het
Tesk1 A G 4: 43,446,000 E311G probably damaging Het
Tmed5 A T 5: 108,126,016 V119E probably damaging Het
Tmem260 T C 14: 48,486,867 S201P possibly damaging Het
Tnxb A G 17: 34,671,733 Y350C probably damaging Het
Tpte T C 8: 22,335,608 probably benign Het
Trim37 A T 11: 87,146,968 D161V probably damaging Het
Trrap C A 5: 144,814,556 Q1640K probably damaging Het
Tspoap1 T C 11: 87,776,346 probably benign Het
Ttk T A 9: 83,847,260 probably benign Het
Vmn1r172 A G 7: 23,660,532 S281G probably benign Het
Vmn1r177 A G 7: 23,865,597 S285P probably damaging Het
Vmn1r231 C T 17: 20,890,399 V85I probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r118 T C 17: 55,608,643 I436V probably benign Het
Vmn2r12 T C 5: 109,092,899 K116R probably benign Het
Vmn2r28 T A 7: 5,488,514 I245L probably benign Het
Wdr26 A T 1: 181,180,651 probably benign Het
Xrcc3 A T 12: 111,809,957 H67Q probably benign Het
Zbbx A T 3: 75,078,495 S417T possibly damaging Het
Zc3h13 A G 14: 75,323,482 D504G unknown Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zyg11b A T 4: 108,255,308 F388I probably damaging Het
Other mutations in Akna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Akna APN 4 63397873 critical splice donor site probably null
IGL00590:Akna APN 4 63371878 missense probably benign 0.00
IGL01567:Akna APN 4 63381850 missense probably benign
IGL01667:Akna APN 4 63379159 missense probably benign 0.34
IGL01820:Akna APN 4 63386258 missense probably benign 0.30
IGL01956:Akna APN 4 63379290 missense probably benign 0.04
IGL02148:Akna APN 4 63382479 splice site probably benign
IGL02502:Akna APN 4 63368203 missense probably benign 0.28
IGL02674:Akna APN 4 63370944 nonsense probably null
IGL02792:Akna APN 4 63377706 missense possibly damaging 0.73
IGL02956:Akna APN 4 63386279 missense probably benign 0.05
R0035:Akna UTSW 4 63382445 missense probably benign 0.16
R0049:Akna UTSW 4 63394635 missense probably damaging 0.97
R0133:Akna UTSW 4 63379361 nonsense probably null
R0422:Akna UTSW 4 63392154 missense probably damaging 1.00
R0578:Akna UTSW 4 63370910 missense probably benign
R0784:Akna UTSW 4 63376888 missense probably benign
R1264:Akna UTSW 4 63381725 splice site probably null
R1539:Akna UTSW 4 63379310 missense probably benign 0.00
R1575:Akna UTSW 4 63379333 missense probably benign 0.01
R1646:Akna UTSW 4 63383892 missense probably benign
R2115:Akna UTSW 4 63395160 missense probably benign 0.01
R2121:Akna UTSW 4 63376900 missense probably benign 0.08
R2324:Akna UTSW 4 63371802 missense possibly damaging 0.92
R2961:Akna UTSW 4 63394944 missense probably benign 0.04
R3150:Akna UTSW 4 63395353 missense possibly damaging 0.80
R3552:Akna UTSW 4 63398124 start codon destroyed probably null 0.53
R3855:Akna UTSW 4 63373468 missense probably damaging 0.98
R4023:Akna UTSW 4 63374390 missense probably benign
R4247:Akna UTSW 4 63395172 missense probably benign 0.00
R4299:Akna UTSW 4 63398032 missense possibly damaging 0.59
R4422:Akna UTSW 4 63387093 missense possibly damaging 0.86
R4499:Akna UTSW 4 63395041 missense probably benign
R4723:Akna UTSW 4 63387032 missense probably benign
R4743:Akna UTSW 4 63378613 missense probably damaging 1.00
R4780:Akna UTSW 4 63379254 missense probably benign
R4903:Akna UTSW 4 63374037 missense probably damaging 1.00
R4936:Akna UTSW 4 63395265 missense probably damaging 0.97
R5041:Akna UTSW 4 63387144 missense possibly damaging 0.67
R5276:Akna UTSW 4 63368203 missense possibly damaging 0.95
R5297:Akna UTSW 4 63381846 missense possibly damaging 0.93
R5546:Akna UTSW 4 63394959 missense probably benign 0.15
R5546:Akna UTSW 4 63395566 missense probably benign
R5773:Akna UTSW 4 63395070 missense probably benign 0.41
R5966:Akna UTSW 4 63394903 missense probably damaging 0.99
R6127:Akna UTSW 4 63368119 missense possibly damaging 0.67
R6176:Akna UTSW 4 63377732 missense probably benign 0.04
R6337:Akna UTSW 4 63374003 missense probably benign 0.00
R6701:Akna UTSW 4 63395280 missense probably benign
R6800:Akna UTSW 4 63398031 missense probably benign
R6931:Akna UTSW 4 63387102 missense probably benign 0.02
R7451:Akna UTSW 4 63378667 missense probably benign 0.16
R7644:Akna UTSW 4 63395397 missense possibly damaging 0.48
R7786:Akna UTSW 4 63394962 missense probably benign
R8182:Akna UTSW 4 63394797 missense probably damaging 1.00
R9136:Akna UTSW 4 63392155 missense probably damaging 1.00
R9178:Akna UTSW 4 63394609 missense possibly damaging 0.95
RF048:Akna UTSW 4 63377841 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACGGATTCTCCAGTACACAGCCTC -3'
(R):5'- TCAGTTCCTTGCATCGTAGACAACC -3'

Sequencing Primer
(F):5'- CAGAGCCGGTGATCTTTCTCTA -3'
(R):5'- atgaagcccagcagtcag -3'
Posted On 2013-04-24