Incidental Mutation 'R4241:Chd1'
ID 320233
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Name chromodomain helicase DNA binding protein 1
Synonyms 4930525N21Rik
MMRRC Submission 041058-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4241 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 15925229-15992872 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 15990289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1614 (R1614*)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627]
AlphaFold P40201
Predicted Effect probably null
Transcript: ENSMUST00000024627
AA Change: R1614*
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: R1614*

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,548,497 (GRCm39) probably benign Het
Ap5b1 C T 19: 5,618,825 (GRCm39) L82F possibly damaging Het
Arfgef3 A G 10: 18,500,912 (GRCm39) S1113P probably damaging Het
Atoh1 A C 6: 64,706,758 (GRCm39) N151T probably damaging Het
Bcas3 T A 11: 85,361,652 (GRCm39) S25R probably damaging Het
Blcap T A 2: 157,402,343 (GRCm39) probably benign Het
Btbd6 C T 12: 112,940,416 (GRCm39) A13V probably benign Het
Ccdc83 A C 7: 89,896,346 (GRCm39) N74K probably damaging Het
Cdh9 A G 15: 16,849,165 (GRCm39) probably null Het
Col16a1 G T 4: 129,992,843 (GRCm39) Q1567H probably damaging Het
Coq6 A T 12: 84,420,563 (GRCm39) probably benign Het
Cpd T C 11: 76,737,611 (GRCm39) D61G probably benign Het
Csnk1e A G 15: 79,309,095 (GRCm39) F277S probably damaging Het
Cyp2d41-ps T A 15: 82,663,787 (GRCm39) noncoding transcript Het
Dbt T C 3: 116,326,945 (GRCm39) I98T probably damaging Het
Eif3e G A 15: 43,126,086 (GRCm39) T287I probably damaging Het
Fcgbpl1 A G 7: 27,853,760 (GRCm39) S1575G probably damaging Het
Gm7135 A G 1: 97,281,678 (GRCm39) noncoding transcript Het
Gpr176 A T 2: 118,110,091 (GRCm39) S389R probably benign Het
Hax1 A G 3: 89,902,997 (GRCm39) S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,355,630 (GRCm39) probably null Het
Ighv1-53 C T 12: 115,122,442 (GRCm39) C5Y probably benign Het
Klhl13 T A X: 23,181,414 (GRCm39) D2V probably damaging Het
Kynu A T 2: 43,571,422 (GRCm39) H446L probably benign Het
Lingo1 A G 9: 56,527,386 (GRCm39) F401S probably damaging Het
Lmbrd1 C T 1: 24,732,049 (GRCm39) Q89* probably null Het
Mov10 T A 3: 104,704,592 (GRCm39) Q773L probably benign Het
Or52e19 G T 7: 102,959,868 (GRCm39) *313Y probably null Het
Or7c70 T A 10: 78,683,739 (GRCm39) R3S probably benign Het
Pde6c G A 19: 38,151,293 (GRCm39) G608S probably damaging Het
Peli3 T C 19: 4,982,426 (GRCm39) H413R probably damaging Het
Pkdrej C T 15: 85,702,345 (GRCm39) R1197Q probably damaging Het
Rcan2 T A 17: 44,264,370 (GRCm39) V10D probably benign Het
Slc10a5 A G 3: 10,400,520 (GRCm39) S47P probably damaging Het
Sprr3 A G 3: 92,364,214 (GRCm39) V210A possibly damaging Het
Tcerg1l G T 7: 137,999,361 (GRCm39) Q8K unknown Het
Ubfd1 T C 7: 121,670,977 (GRCm39) V265A possibly damaging Het
Ubr1 T C 2: 120,764,867 (GRCm39) D529G possibly damaging Het
Vmn1r180 A T 7: 23,652,298 (GRCm39) I154F probably damaging Het
Vmn1r237 A G 17: 21,534,925 (GRCm39) H216R possibly damaging Het
Whrn C T 4: 63,351,210 (GRCm39) probably benign Het
Zfr T G 15: 12,149,745 (GRCm39) D388E probably damaging Het
Zic5 T C 14: 122,702,075 (GRCm39) I219V probably benign Het
Zmat5 A G 11: 4,678,614 (GRCm39) N53D probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15,952,827 (GRCm39) missense probably benign 0.37
IGL01356:Chd1 APN 17 15,970,127 (GRCm39) missense probably damaging 1.00
IGL01369:Chd1 APN 17 15,975,259 (GRCm39) missense probably damaging 0.97
IGL01519:Chd1 APN 17 17,598,831 (GRCm39) missense probably damaging 1.00
IGL01604:Chd1 APN 17 15,990,359 (GRCm39) missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17,598,858 (GRCm39) missense probably damaging 1.00
IGL01721:Chd1 APN 17 15,990,430 (GRCm39) missense probably damaging 1.00
IGL01959:Chd1 APN 17 15,962,435 (GRCm39) missense probably damaging 1.00
IGL02367:Chd1 APN 17 17,610,315 (GRCm39) missense probably damaging 0.98
IGL02476:Chd1 APN 17 15,954,535 (GRCm39) missense probably damaging 1.00
IGL02756:Chd1 APN 17 15,951,069 (GRCm39) missense probably damaging 0.97
IGL02817:Chd1 APN 17 15,969,762 (GRCm39) missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15,990,560 (GRCm39) missense probably benign 0.22
IGL03108:Chd1 APN 17 15,945,543 (GRCm39) missense possibly damaging 0.70
Holly UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0128:Chd1 UTSW 17 17,613,829 (GRCm39) missense probably damaging 1.00
R0197:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0285:Chd1 UTSW 17 17,594,942 (GRCm39) splice site probably benign
R0326:Chd1 UTSW 17 15,988,830 (GRCm39) missense probably benign
R0326:Chd1 UTSW 17 15,988,828 (GRCm39) missense probably damaging 1.00
R0372:Chd1 UTSW 17 17,607,552 (GRCm39) missense probably benign 0.14
R0391:Chd1 UTSW 17 15,970,156 (GRCm39) missense probably damaging 1.00
R0486:Chd1 UTSW 17 15,954,604 (GRCm39) missense probably damaging 0.99
R0637:Chd1 UTSW 17 15,962,550 (GRCm39) missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15,978,523 (GRCm39) unclassified probably benign
R0701:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0788:Chd1 UTSW 17 15,927,376 (GRCm39) missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15,990,503 (GRCm39) missense probably damaging 1.00
R0883:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R1169:Chd1 UTSW 17 15,955,994 (GRCm39) missense probably damaging 1.00
R1218:Chd1 UTSW 17 15,945,574 (GRCm39) missense probably damaging 1.00
R1370:Chd1 UTSW 17 17,607,742 (GRCm39) missense probably benign 0.00
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15,959,769 (GRCm39) missense probably damaging 0.99
R1752:Chd1 UTSW 17 15,963,494 (GRCm39) critical splice donor site probably null
R1759:Chd1 UTSW 17 17,607,533 (GRCm39) missense probably benign 0.00
R1767:Chd1 UTSW 17 15,990,565 (GRCm39) missense probably damaging 1.00
R1938:Chd1 UTSW 17 15,982,748 (GRCm39) missense probably benign 0.39
R2007:Chd1 UTSW 17 15,951,268 (GRCm39) missense probably damaging 1.00
R2069:Chd1 UTSW 17 15,962,556 (GRCm39) missense probably damaging 1.00
R3771:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3773:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3849:Chd1 UTSW 17 15,952,133 (GRCm39) missense probably damaging 1.00
R4242:Chd1 UTSW 17 15,990,289 (GRCm39) nonsense probably null
R4354:Chd1 UTSW 17 17,610,263 (GRCm39) missense probably benign 0.23
R4468:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4469:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4731:Chd1 UTSW 17 17,598,079 (GRCm39) missense probably benign 0.36
R4824:Chd1 UTSW 17 15,953,386 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,016 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,015 (GRCm39) nonsense probably null
R4880:Chd1 UTSW 17 17,594,916 (GRCm39) missense probably damaging 1.00
R4960:Chd1 UTSW 17 15,962,493 (GRCm39) missense probably damaging 0.96
R5071:Chd1 UTSW 17 15,982,667 (GRCm39) missense probably benign
R5078:Chd1 UTSW 17 15,946,616 (GRCm39) missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15,948,460 (GRCm39) missense probably benign 0.25
R5268:Chd1 UTSW 17 15,956,005 (GRCm39) missense probably damaging 1.00
R5304:Chd1 UTSW 17 15,990,530 (GRCm39) missense possibly damaging 0.55
R5304:Chd1 UTSW 17 15,975,213 (GRCm39) missense probably benign 0.01
R5307:Chd1 UTSW 17 15,952,832 (GRCm39) missense probably damaging 1.00
R5458:Chd1 UTSW 17 15,958,811 (GRCm39) missense probably damaging 1.00
R5553:Chd1 UTSW 17 17,605,875 (GRCm39) missense probably benign 0.17
R5623:Chd1 UTSW 17 15,975,194 (GRCm39) missense probably damaging 1.00
R6022:Chd1 UTSW 17 17,598,035 (GRCm39) missense probably benign 0.39
R6137:Chd1 UTSW 17 15,978,950 (GRCm39) missense probably damaging 1.00
R6257:Chd1 UTSW 17 15,950,465 (GRCm39) splice site probably null
R6373:Chd1 UTSW 17 15,958,898 (GRCm39) missense probably damaging 1.00
R6458:Chd1 UTSW 17 15,950,864 (GRCm39) missense probably benign 0.01
R6476:Chd1 UTSW 17 17,601,250 (GRCm39) critical splice donor site probably null
R6508:Chd1 UTSW 17 15,958,895 (GRCm39) missense probably benign 0.31
R6553:Chd1 UTSW 17 15,945,692 (GRCm39) missense probably benign 0.00
R6745:Chd1 UTSW 17 17,607,429 (GRCm39) missense probably benign 0.08
R7107:Chd1 UTSW 17 15,981,628 (GRCm39) missense probably damaging 0.98
R7230:Chd1 UTSW 17 15,927,199 (GRCm39) splice site probably null
R7317:Chd1 UTSW 17 15,962,536 (GRCm39) missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15,990,499 (GRCm39) missense probably damaging 0.99
R7421:Chd1 UTSW 17 15,969,660 (GRCm39) missense probably benign 0.03
R7704:Chd1 UTSW 17 15,987,737 (GRCm39) missense probably benign
R7763:Chd1 UTSW 17 15,953,303 (GRCm39) missense probably damaging 1.00
R8156:Chd1 UTSW 17 15,981,666 (GRCm39) missense probably benign
R8194:Chd1 UTSW 17 17,594,737 (GRCm39) start gained probably benign
R8261:Chd1 UTSW 17 17,607,804 (GRCm39) missense probably benign 0.02
R8338:Chd1 UTSW 17 15,990,242 (GRCm39) missense probably damaging 1.00
R8401:Chd1 UTSW 17 15,963,473 (GRCm39) missense probably damaging 1.00
R8411:Chd1 UTSW 17 15,982,711 (GRCm39) missense probably damaging 0.98
R9067:Chd1 UTSW 17 15,951,107 (GRCm39) missense possibly damaging 0.49
R9184:Chd1 UTSW 17 15,962,551 (GRCm39) missense possibly damaging 0.71
R9210:Chd1 UTSW 17 15,950,767 (GRCm39) missense possibly damaging 0.70
R9212:Chd1 UTSW 17 15,950,767 (GRCm39) missense possibly damaging 0.70
R9666:Chd1 UTSW 17 15,955,976 (GRCm39) missense probably damaging 1.00
R9673:Chd1 UTSW 17 15,989,023 (GRCm39) missense probably benign 0.24
Z1176:Chd1 UTSW 17 15,988,995 (GRCm39) missense probably damaging 1.00
Z1176:Chd1 UTSW 17 15,986,609 (GRCm39) missense probably damaging 0.98
Z1177:Chd1 UTSW 17 15,968,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGTTCTCAGCTACTTTCAG -3'
(R):5'- GATCTAAAGGTGACCTAGGGCC -3'

Sequencing Primer
(F):5'- GTGGTTCTCAGCTACTTTCAGGAAAC -3'
(R):5'- TGACCTAGGGCCACTGCTG -3'
Posted On 2015-06-12