Incidental Mutation 'R4241:Vmn1r237'
ID320234
Institutional Source Beutler Lab
Gene Symbol Vmn1r237
Ensembl Gene ENSMUSG00000058030
Gene Namevomeronasal 1 receptor 237
SynonymsV1rf3
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4241 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21313963-21314912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21314663 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 216 (H216R)
Ref Sequence ENSEMBL: ENSMUSP00000076531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077301]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077301
AA Change: H216R

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076531
Gene: ENSMUSG00000058030
AA Change: H216R

DomainStartEndE-ValueType
Pfam:TAS2R 1 289 7.1e-17 PFAM
Pfam:V1R 34 289 1.9e-34 PFAM
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Bcas3 T A 11: 85,470,826 S25R probably damaging Het
Blcap T A 2: 157,560,423 probably benign Het
Btbd6 C T 12: 112,976,796 A13V probably benign Het
Ccdc83 A C 7: 90,247,138 N74K probably damaging Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Coq6 A T 12: 84,373,789 probably benign Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Slc10a5 A G 3: 10,335,460 S47P probably damaging Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Tcerg1l G T 7: 138,397,632 Q8K unknown Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Vmn1r237
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Vmn1r237 APN 17 21314075 missense probably damaging 0.97
IGL02746:Vmn1r237 APN 17 21314218 missense possibly damaging 0.96
IGL03112:Vmn1r237 APN 17 21314106 nonsense probably null
IGL03351:Vmn1r237 APN 17 21314837 missense probably benign 0.06
R0478:Vmn1r237 UTSW 17 21314819 missense probably damaging 1.00
R0514:Vmn1r237 UTSW 17 21314670 missense possibly damaging 0.63
R0616:Vmn1r237 UTSW 17 21314623 missense probably damaging 1.00
R0865:Vmn1r237 UTSW 17 21314714 missense probably damaging 0.99
R1590:Vmn1r237 UTSW 17 21314039 missense probably damaging 0.99
R3022:Vmn1r237 UTSW 17 21314447 missense probably damaging 0.99
R4242:Vmn1r237 UTSW 17 21314663 missense possibly damaging 0.63
R4646:Vmn1r237 UTSW 17 21314138 missense probably benign 0.02
R5144:Vmn1r237 UTSW 17 21314426 missense possibly damaging 0.96
R5229:Vmn1r237 UTSW 17 21314371 missense probably benign 0.00
R5334:Vmn1r237 UTSW 17 21314680 missense probably benign 0.00
R5800:Vmn1r237 UTSW 17 21314807 missense probably benign 0.05
R5898:Vmn1r237 UTSW 17 21314551 missense probably damaging 0.99
R6190:Vmn1r237 UTSW 17 21314294 missense probably damaging 1.00
R6472:Vmn1r237 UTSW 17 21314354 missense probably benign 0.16
R6811:Vmn1r237 UTSW 17 21314386 missense probably benign 0.02
X0011:Vmn1r237 UTSW 17 21314055 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCCCATGGACATGAGAGCAAG -3'
(R):5'- AGTTGGGAAACATGCAGTAACTAC -3'

Sequencing Primer
(F):5'- CAATAGGAACATTACACGCCTAAGGG -3'
(R):5'- GTAACTACTGAAGCCATGTTCAC -3'
Posted On2015-06-12