Incidental Mutation 'R4241:Rcan2'
ID320235
Institutional Source Beutler Lab
Gene Symbol Rcan2
Ensembl Gene ENSMUSG00000039601
Gene Nameregulator of calcineurin 2
SynonymsCsp2, ZAKI-4, MCIP2, Dscr1l1
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4241 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43801351-44039516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43953479 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 10 (V10D)
Ref Sequence ENSEMBL: ENSMUSP00000155555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044792] [ENSMUST00000044895] [ENSMUST00000177857] [ENSMUST00000228972] [ENSMUST00000229240] [ENSMUST00000229744]
Predicted Effect probably benign
Transcript: ENSMUST00000044792
AA Change: V10D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000048013
Gene: ENSMUSG00000039601
AA Change: V10D

DomainStartEndE-ValueType
Pfam:Calcipressin 20 191 2.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044895
SMART Domains Protein: ENSMUSP00000039473
Gene: ENSMUSG00000039601

DomainStartEndE-ValueType
Pfam:Calcipressin 66 237 1.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177857
AA Change: V10D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137211
Gene: ENSMUSG00000039601
AA Change: V10D

DomainStartEndE-ValueType
Pfam:Calcipressin 20 191 2.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228972
Predicted Effect probably benign
Transcript: ENSMUST00000229240
AA Change: V10D

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000229744
Meta Mutation Damage Score 0.1270 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out alle exhibit decreased body weight and resistance to diet-induced obesity, steatosis, glucose intolerance, and insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Bcas3 T A 11: 85,470,826 S25R probably damaging Het
Blcap T A 2: 157,560,423 probably benign Het
Btbd6 C T 12: 112,976,796 A13V probably benign Het
Ccdc83 A C 7: 90,247,138 N74K probably damaging Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Coq6 A T 12: 84,373,789 probably benign Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Slc10a5 A G 3: 10,335,460 S47P probably damaging Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Tcerg1l G T 7: 138,397,632 Q8K unknown Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Rcan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Rcan2 APN 17 44037069 missense possibly damaging 0.61
IGL00430:Rcan2 APN 17 43836384 missense probably benign 0.08
IGL00958:Rcan2 APN 17 44037017 missense probably damaging 1.00
IGL01121:Rcan2 APN 17 44017884 missense probably damaging 0.99
IGL01397:Rcan2 APN 17 43836468 missense possibly damaging 0.56
IGL01897:Rcan2 APN 17 43836434 missense probably damaging 0.99
R1510:Rcan2 UTSW 17 43836424 missense probably damaging 1.00
R1803:Rcan2 UTSW 17 44037033 missense probably damaging 1.00
R1862:Rcan2 UTSW 17 44037089 splice site probably null
R3841:Rcan2 UTSW 17 44036979 missense probably benign 0.25
R4402:Rcan2 UTSW 17 43953470 missense probably benign 0.00
R4955:Rcan2 UTSW 17 44037081 missense probably damaging 1.00
R5014:Rcan2 UTSW 17 44017813 missense probably damaging 1.00
R5470:Rcan2 UTSW 17 43836283 missense probably benign 0.02
R5555:Rcan2 UTSW 17 44037030 missense probably damaging 1.00
R6393:Rcan2 UTSW 17 43953479 missense probably benign 0.03
R6478:Rcan2 UTSW 17 43836334 missense probably benign
R7007:Rcan2 UTSW 17 43836325 missense probably benign
R7307:Rcan2 UTSW 17 44021102 nonsense probably null
R7602:Rcan2 UTSW 17 44017798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGGCCTCTGTGATGATGTC -3'
(R):5'- CTTGCCTTCGTGGTACAAAC -3'

Sequencing Primer
(F):5'- AGAGAGCCGGGTCCTTCTTTAC -3'
(R):5'- CTTCGTGGTACAAACAGTAAAACTGC -3'
Posted On2015-06-12