Mutagenetix > Incidental Mutations

Incidental Mutation 'R4241:Rcan2'

320235

Institutional Source

Beutler Lab

Gene Symbol

Rcan2

Ensembl Gene

ENSMUSG00000039601

Gene Name

regulator of calcineurin 2

Synonyms

Csp2, ZAKI-4, MCIP2, Dscr1l1

MMRRC Submission

041058-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R4241 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43801351-44039516 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43953479 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 10 (V10D)

Ref Sequence

ENSEMBL: ENSMUSP00000155555 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044792] [ENSMUST00000044895] [ENSMUST00000177857] [ENSMUST00000228972] [ENSMUST00000229240] [ENSMUST00000229744]

Predicted Effect

probably benign
Transcript: ENSMUST00000044792
AA Change: V10D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000048013
Gene: ENSMUSG00000039601
AA Change: V10D

Domain	Start	End	E-Value	Type
Pfam:Calcipressin	20	191	2.1e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000044895

SMART Domains

Protein: ENSMUSP00000039473
Gene: ENSMUSG00000039601

Domain	Start	End	E-Value	Type
Pfam:Calcipressin	66	237	1.3e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177857
AA Change: V10D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000137211
Gene: ENSMUSG00000039601
AA Change: V10D

Domain	Start	End	E-Value	Type
Pfam:Calcipressin	20	191	2.1e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000228972

Predicted Effect

probably benign
Transcript: ENSMUST00000229240
AA Change: V10D

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

probably benign
Transcript: ENSMUST00000229744

Meta Mutation Damage Score

0.1270

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out alle exhibit decreased body weight and resistance to diet-induced obesity, steatosis, glucose intolerance, and insulin sensitivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,154,335	S1575G	probably damaging	Het
Agl	A	T	3: 116,754,848		probably benign	Het
Ap5b1	C	T	19: 5,568,797	L82F	possibly damaging	Het
Arfgef3	A	G	10: 18,625,164	S1113P	probably damaging	Het
Atoh1	A	C	6: 64,729,774	N151T	probably damaging	Het
Bcas3	T	A	11: 85,470,826	S25R	probably damaging	Het
Blcap	T	A	2: 157,560,423		probably benign	Het
Btbd6	C	T	12: 112,976,796	A13V	probably benign	Het
Ccdc83	A	C	7: 90,247,138	N74K	probably damaging	Het
Cdh9	A	G	15: 16,849,079		probably null	Het
Chd1	C	T	17: 15,770,027	R1614*	probably null	Het
Col16a1	G	T	4: 130,099,050	Q1567H	probably damaging	Het
Coq6	A	T	12: 84,373,789		probably benign	Het
Cpd	T	C	11: 76,846,785	D61G	probably benign	Het
Csnk1e	A	G	15: 79,424,895	F277S	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,779,586		noncoding transcript	Het
Dbt	T	C	3: 116,533,296	I98T	probably damaging	Het
Eif3e	G	A	15: 43,262,690	T287I	probably damaging	Het
Gm7135	A	G	1: 97,353,953		noncoding transcript	Het
Gpr176	A	T	2: 118,279,610	S389R	probably benign	Het
Hax1	A	G	3: 89,995,690	S257P	probably damaging	Het
Herc1	CTGAGGACTCTTTG	CTG	9: 66,448,348		probably null	Het
Ighv1-53	C	T	12: 115,158,822	C5Y	probably benign	Het
Klhl13	T	A	X: 23,315,175	D2V	probably damaging	Het
Kynu	A	T	2: 43,681,410	H446L	probably benign	Het
Lingo1	A	G	9: 56,620,102	F401S	probably damaging	Het
Lmbrd1	C	T	1: 24,692,968	Q89*	probably null	Het
Mov10	T	A	3: 104,797,276	Q773L	probably benign	Het
Olfr1356	T	A	10: 78,847,905	R3S	probably benign	Het
Olfr596	G	T	7: 103,310,661	*313Y	probably null	Het
Pde6c	G	A	19: 38,162,845	G608S	probably damaging	Het
Peli3	T	C	19: 4,932,398	H413R	probably damaging	Het
Pkdrej	C	T	15: 85,818,144	R1197Q	probably damaging	Het
Slc10a5	A	G	3: 10,335,460	S47P	probably damaging	Het
Sprr3	A	G	3: 92,456,907	V210A	possibly damaging	Het
Tcerg1l	G	T	7: 138,397,632	Q8K	unknown	Het
Ubfd1	T	C	7: 122,071,754	V265A	possibly damaging	Het
Ubr1	T	C	2: 120,934,386	D529G	possibly damaging	Het
Vmn1r180	A	T	7: 23,952,873	I154F	probably damaging	Het
Vmn1r237	A	G	17: 21,314,663	H216R	possibly damaging	Het
Whrn	C	T	4: 63,432,973		probably benign	Het
Zfr	T	G	15: 12,149,659	D388E	probably damaging	Het
Zic5	T	C	14: 122,464,663	I219V	probably benign	Het
Zmat5	A	G	11: 4,728,614	N53D	probably benign	Het

Other mutations in Rcan2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Rcan2	APN	17	44037069	missense	possibly damaging	0.61
IGL00430:Rcan2	APN	17	43836384	missense	probably benign	0.08
IGL00958:Rcan2	APN	17	44037017	missense	probably damaging	1.00
IGL01121:Rcan2	APN	17	44017884	missense	probably damaging	0.99
IGL01397:Rcan2	APN	17	43836468	missense	possibly damaging	0.56
IGL01897:Rcan2	APN	17	43836434	missense	probably damaging	0.99
R1510:Rcan2	UTSW	17	43836424	missense	probably damaging	1.00
R1803:Rcan2	UTSW	17	44037033	missense	probably damaging	1.00
R1862:Rcan2	UTSW	17	44037089	splice site	probably null
R3841:Rcan2	UTSW	17	44036979	missense	probably benign	0.25
R4402:Rcan2	UTSW	17	43953470	missense	probably benign	0.00
R4955:Rcan2	UTSW	17	44037081	missense	probably damaging	1.00
R5014:Rcan2	UTSW	17	44017813	missense	probably damaging	1.00
R5470:Rcan2	UTSW	17	43836283	missense	probably benign	0.02
R5555:Rcan2	UTSW	17	44037030	missense	probably damaging	1.00
R6393:Rcan2	UTSW	17	43953479	missense	probably benign	0.03
R6478:Rcan2	UTSW	17	43836334	missense	probably benign
R7007:Rcan2	UTSW	17	43836325	missense	probably benign
R7307:Rcan2	UTSW	17	44021102	nonsense	probably null
R7602:Rcan2	UTSW	17	44017798	missense	probably benign	0.00
R9044:Rcan2	UTSW	17	43836354	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- TCGGCCTCTGTGATGATGTC -3'
(R):5'- CTTGCCTTCGTGGTACAAAC -3'

Sequencing Primer
(F):5'- AGAGAGCCGGGTCCTTCTTTAC -3'
(R):5'- CTTCGTGGTACAAACAGTAAAACTGC -3'

Posted On

2015-06-12