Incidental Mutation 'R4241:Pde6c'
ID320238
Institutional Source Beutler Lab
Gene Symbol Pde6c
Ensembl Gene ENSMUSG00000024992
Gene Namephosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonymscpfl1
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4241 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location38132781-38183958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38162845 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 608 (G608S)
Ref Sequence ENSEMBL: ENSMUSP00000107948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025956] [ENSMUST00000112329]
Predicted Effect probably damaging
Transcript: ENSMUST00000025956
AA Change: G608S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025956
Gene: ENSMUSG00000024992
AA Change: G608S

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 7.57e-9 SMART
low complexity region 827 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112329
AA Change: G608S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107948
Gene: ENSMUSG00000024992
AA Change: G608S

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 1.62e-8 SMART
low complexity region 802 811 N/A INTRINSIC
Meta Mutation Damage Score 0.9539 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-prime subunit of cone phosphodiesterase, which is composed of a homodimer of two alpha-prime subunits and 3 smaller proteins of 11, 13, and 15 kDa. Mutations in this gene are associated with cone dystrophy type 4 (COD4). [provided by RefSeq, Mar 2010]
PHENOTYPE: A spontaneous mutation in this gene results in abnormal cone photoreceptor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Bcas3 T A 11: 85,470,826 S25R probably damaging Het
Blcap T A 2: 157,560,423 probably benign Het
Btbd6 C T 12: 112,976,796 A13V probably benign Het
Ccdc83 A C 7: 90,247,138 N74K probably damaging Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Coq6 A T 12: 84,373,789 probably benign Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Slc10a5 A G 3: 10,335,460 S47P probably damaging Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Tcerg1l G T 7: 138,397,632 Q8K unknown Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Pde6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Pde6c APN 19 38162876 splice site probably benign
IGL01333:Pde6c APN 19 38175695 missense probably benign 0.05
IGL01390:Pde6c APN 19 38161928 missense probably benign 0.01
IGL02508:Pde6c APN 19 38157500 missense probably benign 0.13
IGL02542:Pde6c APN 19 38178130 missense probably damaging 1.00
IGL02546:Pde6c APN 19 38140040 missense probably benign 0.00
IGL02661:Pde6c APN 19 38180800 missense probably damaging 0.97
silverton UTSW 19 38162845 missense probably damaging 1.00
IGL03097:Pde6c UTSW 19 38178271 missense probably damaging 1.00
R0117:Pde6c UTSW 19 38151531 missense probably damaging 1.00
R0128:Pde6c UTSW 19 38169365 splice site probably benign
R0349:Pde6c UTSW 19 38162349 missense probably damaging 1.00
R0612:Pde6c UTSW 19 38133246 missense probably benign 0.03
R0692:Pde6c UTSW 19 38180250 missense probably damaging 0.99
R0785:Pde6c UTSW 19 38133180 missense probably benign
R1605:Pde6c UTSW 19 38141492 missense probably damaging 1.00
R1643:Pde6c UTSW 19 38161958 missense possibly damaging 0.56
R1694:Pde6c UTSW 19 38180225 missense probably damaging 1.00
R1781:Pde6c UTSW 19 38151698 missense possibly damaging 0.69
R1900:Pde6c UTSW 19 38161940 missense probably damaging 1.00
R1944:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R1945:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R2143:Pde6c UTSW 19 38162329 missense probably damaging 1.00
R2497:Pde6c UTSW 19 38153694 missense probably damaging 1.00
R3737:Pde6c UTSW 19 38140224 missense probably damaging 1.00
R4010:Pde6c UTSW 19 38169436 missense probably damaging 1.00
R4242:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4259:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4661:Pde6c UTSW 19 38169439 missense probably damaging 1.00
R4677:Pde6c UTSW 19 38157385 missense probably damaging 1.00
R4708:Pde6c UTSW 19 38180893 missense possibly damaging 0.92
R4889:Pde6c UTSW 19 38133151 missense probably benign 0.23
R4898:Pde6c UTSW 19 38150624 missense possibly damaging 0.81
R4941:Pde6c UTSW 19 38151565 missense probably damaging 1.00
R5448:Pde6c UTSW 19 38133175 missense probably damaging 1.00
R6174:Pde6c UTSW 19 38140229 missense possibly damaging 0.57
R6249:Pde6c UTSW 19 38158560 critical splice donor site probably null
R6270:Pde6c UTSW 19 38158436 missense probably damaging 1.00
R7183:Pde6c UTSW 19 38133090 missense probably benign 0.00
R7428:Pde6c UTSW 19 38157536 critical splice donor site probably null
R7429:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7430:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7643:Pde6c UTSW 19 38141421 missense probably damaging 1.00
R7793:Pde6c UTSW 19 38159753 missense possibly damaging 0.94
R7811:Pde6c UTSW 19 38140059 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAAACTGTCTGGGATGCCAC -3'
(R):5'- AGCTTGTAGCCCATCCTGAGAC -3'

Sequencing Primer
(F):5'- CCTAACCTTTGGTAGAAACGTGACG -3'
(R):5'- AGTACAGGTCAGTGCAGT -3'
Posted On2015-06-12