Incidental Mutation 'R4242:Mpl'
ID 320245
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Name myeloproliferative leukemia virus oncogene
Synonyms c-mpl-I, TPO-R, thrombopoietin receptor, c-mpl, CD110, hlb219, c-mpl-II
MMRRC Submission 041059-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4242 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118299612-118314710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118313968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 99 (D99V)
Ref Sequence ENSEMBL: ENSMUSP00000099732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]
AlphaFold Q08351
Predicted Effect unknown
Transcript: ENSMUST00000006556
AA Change: D99V
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389
AA Change: D99V

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102671
AA Change: D99V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389
AA Change: D99V

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106375
AA Change: D92V

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389
AA Change: D92V

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168404
AA Change: D98V
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389
AA Change: D98V

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216417
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 C T 5: 105,109,079 (GRCm39) R406H probably benign Het
Blcap T A 2: 157,402,343 (GRCm39) probably benign Het
Chd1 C T 17: 15,990,289 (GRCm39) R1614* probably null Het
Col6a2 C T 10: 76,443,940 (GRCm39) probably null Het
Csnk1e A G 15: 79,309,095 (GRCm39) F277S probably damaging Het
Dock5 T C 14: 68,065,939 (GRCm39) T355A probably benign Het
Dst G A 1: 34,045,297 (GRCm39) C148Y possibly damaging Het
Faim2 T A 15: 99,398,082 (GRCm39) I289F probably damaging Het
Gm4841 A G 18: 60,403,755 (GRCm39) S113P probably benign Het
Heatr5b A G 17: 79,064,351 (GRCm39) S1879P probably benign Het
Igll1 C A 16: 16,681,564 (GRCm39) G64C probably benign Het
Klhdc7a G A 4: 139,694,032 (GRCm39) P305L probably benign Het
Klhl13 T A X: 23,181,414 (GRCm39) D2V probably damaging Het
Kmt2e T C 5: 23,707,820 (GRCm39) probably benign Het
Lrmda C A 14: 22,077,303 (GRCm39) Y13* probably null Het
Mad2l1bp T C 17: 46,463,913 (GRCm39) E37G possibly damaging Het
Mphosph8 T C 14: 56,911,771 (GRCm39) S265P probably benign Het
Notch3 C T 17: 32,362,719 (GRCm39) G1302D possibly damaging Het
Odaph A G 5: 92,142,749 (GRCm39) I104V probably benign Het
Or10a48 A G 7: 108,424,666 (GRCm39) V180A probably benign Het
Or2a25 A T 6: 42,888,480 (GRCm39) I8F possibly damaging Het
Pde6c G A 19: 38,151,293 (GRCm39) G608S probably damaging Het
Phf20 A G 2: 156,149,374 (GRCm39) probably benign Het
Pkdrej C T 15: 85,702,345 (GRCm39) R1197Q probably damaging Het
Prex2 C T 1: 11,226,528 (GRCm39) H764Y probably benign Het
Rtel1 T C 2: 180,991,727 (GRCm39) F375S probably damaging Het
Spanxn4 T C 12: 62,734,983 (GRCm39) noncoding transcript Het
Taf1 T C X: 100,588,109 (GRCm39) I457T probably benign Het
Tle3 A T 9: 61,314,705 (GRCm39) M233L probably benign Het
Trpv3 T C 11: 73,168,649 (GRCm39) I72T probably benign Het
Vmn1r237 A G 17: 21,534,925 (GRCm39) H216R possibly damaging Het
Xpnpep3 T A 15: 81,311,857 (GRCm39) F188I probably benign Het
Zfp69 G A 4: 120,791,672 (GRCm39) probably benign Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118,312,858 (GRCm39) missense possibly damaging 0.94
IGL02096:Mpl APN 4 118,314,333 (GRCm39) missense possibly damaging 0.46
IGL02681:Mpl APN 4 118,306,068 (GRCm39) splice site probably benign
R0238:Mpl UTSW 4 118,314,060 (GRCm39) splice site probably benign
R0309:Mpl UTSW 4 118,303,235 (GRCm39) intron probably benign
R0539:Mpl UTSW 4 118,300,705 (GRCm39) missense possibly damaging 0.68
R0558:Mpl UTSW 4 118,301,217 (GRCm39) missense probably damaging 0.99
R0601:Mpl UTSW 4 118,300,733 (GRCm39) missense probably benign 0.08
R0784:Mpl UTSW 4 118,303,603 (GRCm39) missense possibly damaging 0.59
R1016:Mpl UTSW 4 118,306,110 (GRCm39) missense probably damaging 1.00
R1532:Mpl UTSW 4 118,305,765 (GRCm39) missense possibly damaging 0.63
R1590:Mpl UTSW 4 118,301,221 (GRCm39) missense probably damaging 0.99
R1806:Mpl UTSW 4 118,300,729 (GRCm39) missense possibly damaging 0.73
R1875:Mpl UTSW 4 118,314,026 (GRCm39) missense probably benign
R1935:Mpl UTSW 4 118,312,936 (GRCm39) missense probably benign 0.01
R2182:Mpl UTSW 4 118,314,610 (GRCm39) missense probably benign
R2291:Mpl UTSW 4 118,306,197 (GRCm39) missense probably benign 0.04
R2508:Mpl UTSW 4 118,312,954 (GRCm39) missense probably damaging 1.00
R4718:Mpl UTSW 4 118,313,921 (GRCm39) missense probably benign 0.02
R4775:Mpl UTSW 4 118,305,777 (GRCm39) missense probably damaging 1.00
R5158:Mpl UTSW 4 118,313,881 (GRCm39) missense probably damaging 0.98
R5208:Mpl UTSW 4 118,313,078 (GRCm39) missense probably benign 0.00
R5276:Mpl UTSW 4 118,312,918 (GRCm39) missense probably benign
R5953:Mpl UTSW 4 118,311,708 (GRCm39) missense probably damaging 0.99
R5953:Mpl UTSW 4 118,311,707 (GRCm39) missense possibly damaging 0.89
R6439:Mpl UTSW 4 118,305,750 (GRCm39) missense probably damaging 0.98
R6450:Mpl UTSW 4 118,305,897 (GRCm39) splice site probably null
R6521:Mpl UTSW 4 118,312,314 (GRCm39) critical splice donor site probably null
R6812:Mpl UTSW 4 118,312,461 (GRCm39) missense probably benign 0.03
R6876:Mpl UTSW 4 118,314,317 (GRCm39) missense probably damaging 1.00
R7095:Mpl UTSW 4 118,301,260 (GRCm39) missense
R7100:Mpl UTSW 4 118,314,607 (GRCm39) missense
R7173:Mpl UTSW 4 118,305,741 (GRCm39) critical splice donor site probably null
R7177:Mpl UTSW 4 118,305,741 (GRCm39) critical splice donor site probably null
R7512:Mpl UTSW 4 118,306,089 (GRCm39) missense
R8377:Mpl UTSW 4 118,301,254 (GRCm39) missense
R8411:Mpl UTSW 4 118,303,306 (GRCm39) missense
R8458:Mpl UTSW 4 118,301,213 (GRCm39) critical splice donor site probably null
R8498:Mpl UTSW 4 118,306,207 (GRCm39) missense probably benign
R8672:Mpl UTSW 4 118,306,110 (GRCm39) missense probably damaging 1.00
R8863:Mpl UTSW 4 118,314,602 (GRCm39) missense
R8904:Mpl UTSW 4 118,301,263 (GRCm39) missense
Z1177:Mpl UTSW 4 118,300,852 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGTTCCAGATGCCAAGGCTAG -3'
(R):5'- CTACCTCCAGCAGTGAGAAG -3'

Sequencing Primer
(F):5'- GGTACCCACATCGTCCTGAAAG -3'
(R):5'- TACCTCCAGCAGTGAGAAGAAAACG -3'
Posted On 2015-06-12