Incidental Mutation 'R4242:Abcg3'
ID 320250
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission 041059-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R4242 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105109079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 406 (R406H)
Ref Sequence ENSEMBL: ENSMUSP00000120179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably benign
Transcript: ENSMUST00000031239
AA Change: R406H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: R406H

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130644
AA Change: R406H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: R406H

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Blcap T A 2: 157,402,343 (GRCm39) probably benign Het
Chd1 C T 17: 15,990,289 (GRCm39) R1614* probably null Het
Col6a2 C T 10: 76,443,940 (GRCm39) probably null Het
Csnk1e A G 15: 79,309,095 (GRCm39) F277S probably damaging Het
Dock5 T C 14: 68,065,939 (GRCm39) T355A probably benign Het
Dst G A 1: 34,045,297 (GRCm39) C148Y possibly damaging Het
Faim2 T A 15: 99,398,082 (GRCm39) I289F probably damaging Het
Gm4841 A G 18: 60,403,755 (GRCm39) S113P probably benign Het
Heatr5b A G 17: 79,064,351 (GRCm39) S1879P probably benign Het
Igll1 C A 16: 16,681,564 (GRCm39) G64C probably benign Het
Klhdc7a G A 4: 139,694,032 (GRCm39) P305L probably benign Het
Klhl13 T A X: 23,181,414 (GRCm39) D2V probably damaging Het
Kmt2e T C 5: 23,707,820 (GRCm39) probably benign Het
Lrmda C A 14: 22,077,303 (GRCm39) Y13* probably null Het
Mad2l1bp T C 17: 46,463,913 (GRCm39) E37G possibly damaging Het
Mphosph8 T C 14: 56,911,771 (GRCm39) S265P probably benign Het
Mpl T A 4: 118,313,968 (GRCm39) D99V probably damaging Het
Notch3 C T 17: 32,362,719 (GRCm39) G1302D possibly damaging Het
Odaph A G 5: 92,142,749 (GRCm39) I104V probably benign Het
Or10a48 A G 7: 108,424,666 (GRCm39) V180A probably benign Het
Or2a25 A T 6: 42,888,480 (GRCm39) I8F possibly damaging Het
Pde6c G A 19: 38,151,293 (GRCm39) G608S probably damaging Het
Phf20 A G 2: 156,149,374 (GRCm39) probably benign Het
Pkdrej C T 15: 85,702,345 (GRCm39) R1197Q probably damaging Het
Prex2 C T 1: 11,226,528 (GRCm39) H764Y probably benign Het
Rtel1 T C 2: 180,991,727 (GRCm39) F375S probably damaging Het
Spanxn4 T C 12: 62,734,983 (GRCm39) noncoding transcript Het
Taf1 T C X: 100,588,109 (GRCm39) I457T probably benign Het
Tle3 A T 9: 61,314,705 (GRCm39) M233L probably benign Het
Trpv3 T C 11: 73,168,649 (GRCm39) I72T probably benign Het
Vmn1r237 A G 17: 21,534,925 (GRCm39) H216R possibly damaging Het
Xpnpep3 T A 15: 81,311,857 (GRCm39) F188I probably benign Het
Zfp69 G A 4: 120,791,672 (GRCm39) probably benign Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0510:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0530:Abcg3 UTSW 5 105,083,920 (GRCm39) missense probably damaging 1.00
R0579:Abcg3 UTSW 5 105,121,969 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5225:Abcg3 UTSW 5 105,114,649 (GRCm39) missense probably damaging 1.00
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6814:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 105,114,632 (GRCm39) missense probably benign 0.01
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7728:Abcg3 UTSW 5 105,083,944 (GRCm39) missense probably benign 0.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9181:Abcg3 UTSW 5 105,121,962 (GRCm39) missense probably benign
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
R9641:Abcg3 UTSW 5 105,084,483 (GRCm39) missense probably benign
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGGCTCTTTCTCTCAGC -3'
(R):5'- TACTAGCAGTCTATAAACATGTGCG -3'

Sequencing Primer
(F):5'- CTCTCAGCTTTCAATGTACTACAC -3'
(R):5'- CAGGATTCTGGTCAAAATATGGTG -3'
Posted On 2015-06-12