Incidental Mutation 'R4242:Abcg3'
ID320250
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene NameATP binding cassette subfamily G member 3
SynonymsMxr2, Abcp2
MMRRC Submission 041059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4242 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104935057-104982718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104961213 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 406 (R406H)
Ref Sequence ENSEMBL: ENSMUSP00000120179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
Predicted Effect probably benign
Transcript: ENSMUST00000031239
AA Change: R406H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: R406H

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130644
AA Change: R406H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: R406H

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Blcap T A 2: 157,560,423 probably benign Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col6a2 C T 10: 76,608,106 probably null Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Dock5 T C 14: 67,828,490 T355A probably benign Het
Dst G A 1: 34,006,216 C148Y possibly damaging Het
Faim2 T A 15: 99,500,201 I289F probably damaging Het
Gm4841 A G 18: 60,270,683 S113P probably benign Het
Heatr5b A G 17: 78,756,922 S1879P probably benign Het
Igll1 C A 16: 16,863,700 G64C probably benign Het
Klhdc7a G A 4: 139,966,721 P305L probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kmt2e T C 5: 23,502,822 probably benign Het
Lrmda C A 14: 22,027,235 Y13* probably null Het
Mad2l1bp T C 17: 46,152,987 E37G possibly damaging Het
Mphosph8 T C 14: 56,674,314 S265P probably benign Het
Mpl T A 4: 118,456,771 D99V probably damaging Het
Notch3 C T 17: 32,143,745 G1302D possibly damaging Het
Odaph A G 5: 91,994,890 I104V probably benign Het
Olfr447 A T 6: 42,911,546 I8F possibly damaging Het
Olfr514 A G 7: 108,825,459 V180A probably benign Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Phf20 A G 2: 156,307,454 probably benign Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Prex2 C T 1: 11,156,304 H764Y probably benign Het
Rtel1 T C 2: 181,349,934 F375S probably damaging Het
Spanxn4 T C 12: 62,688,197 noncoding transcript Het
Taf1 T C X: 101,544,503 I457T probably benign Het
Tle3 A T 9: 61,407,423 M233L probably benign Het
Trpv3 T C 11: 73,277,823 I72T probably benign Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Xpnpep3 T A 15: 81,427,656 F188I probably benign Het
Zfp69 G A 4: 120,934,475 probably benign Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 104936012 missense probably benign 0.02
IGL01363:Abcg3 APN 5 104948362 missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 104961186 missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 104969452 missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 104977670 missense probably benign 0.18
IGL02974:Abcg3 APN 5 104968263 missense probably damaging 1.00
IGL03058:Abcg3 APN 5 104961246 missense probably benign 0.00
IGL03153:Abcg3 APN 5 104974765 splice site probably benign
IGL03377:Abcg3 APN 5 104948390 missense probably benign 0.01
R0110:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0469:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0510:Abcg3 UTSW 5 104977616 missense probably damaging 0.97
R0530:Abcg3 UTSW 5 104936054 missense probably damaging 1.00
R0579:Abcg3 UTSW 5 104974103 missense probably damaging 1.00
R1237:Abcg3 UTSW 5 104948357 missense probably damaging 0.96
R1505:Abcg3 UTSW 5 104951565 missense probably damaging 1.00
R1627:Abcg3 UTSW 5 104936014 missense probably benign 0.00
R1717:Abcg3 UTSW 5 104963555 nonsense probably null
R1797:Abcg3 UTSW 5 104939164 missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 104938199 missense probably damaging 0.99
R1974:Abcg3 UTSW 5 104963638 missense probably benign 0.01
R2136:Abcg3 UTSW 5 104966814 missense probably benign 0.04
R2285:Abcg3 UTSW 5 104939171 missense probably damaging 1.00
R3880:Abcg3 UTSW 5 104938180 splice site probably benign
R4738:Abcg3 UTSW 5 104973983 missense probably benign
R5225:Abcg3 UTSW 5 104966783 missense probably damaging 1.00
R5309:Abcg3 UTSW 5 104936599 missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5705:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R5785:Abcg3 UTSW 5 104968170 missense probably damaging 0.96
R6155:Abcg3 UTSW 5 104963644 missense probably benign 0.00
R6309:Abcg3 UTSW 5 104969393 critical splice donor site probably null
R6814:Abcg3 UTSW 5 104935994 missense probably benign
R6872:Abcg3 UTSW 5 104935994 missense probably benign
R6916:Abcg3 UTSW 5 104974735 missense probably benign 0.16
R7217:Abcg3 UTSW 5 104939228 missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 104966766 missense probably benign 0.01
R7343:Abcg3 UTSW 5 104968234 missense probably benign 0.00
R7401:Abcg3 UTSW 5 104966774 missense probably damaging 0.99
R7531:Abcg3 UTSW 5 104977641 missense probably benign
X0022:Abcg3 UTSW 5 104948416 missense probably benign 0.02
X0026:Abcg3 UTSW 5 104938189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGGCTCTTTCTCTCAGC -3'
(R):5'- TACTAGCAGTCTATAAACATGTGCG -3'

Sequencing Primer
(F):5'- CTCTCAGCTTTCAATGTACTACAC -3'
(R):5'- CAGGATTCTGGTCAAAATATGGTG -3'
Posted On2015-06-12