Incidental Mutation 'R4242:Olfr514'
ID320252
Institutional Source Beutler Lab
Gene Symbol Olfr514
Ensembl Gene ENSMUSG00000066241
Gene Nameolfactory receptor 514
SynonymsMOR268-1, GA_x6K02T2PBJ9-11156311-11155379
MMRRC Submission 041059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4242 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108825065-108825997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108825459 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 180 (V180A)
Ref Sequence ENSEMBL: ENSMUSP00000081807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084754]
Predicted Effect probably benign
Transcript: ENSMUST00000084754
AA Change: V180A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081807
Gene: ENSMUSG00000066241
AA Change: V180A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 3.9e-57 PFAM
Pfam:7tm_1 40 289 5e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 C T 5: 104,961,213 R406H probably benign Het
Blcap T A 2: 157,560,423 probably benign Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col6a2 C T 10: 76,608,106 probably null Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Dock5 T C 14: 67,828,490 T355A probably benign Het
Dst G A 1: 34,006,216 C148Y possibly damaging Het
Faim2 T A 15: 99,500,201 I289F probably damaging Het
Gm4841 A G 18: 60,270,683 S113P probably benign Het
Heatr5b A G 17: 78,756,922 S1879P probably benign Het
Igll1 C A 16: 16,863,700 G64C probably benign Het
Klhdc7a G A 4: 139,966,721 P305L probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kmt2e T C 5: 23,502,822 probably benign Het
Lrmda C A 14: 22,027,235 Y13* probably null Het
Mad2l1bp T C 17: 46,152,987 E37G possibly damaging Het
Mphosph8 T C 14: 56,674,314 S265P probably benign Het
Mpl T A 4: 118,456,771 D99V probably damaging Het
Notch3 C T 17: 32,143,745 G1302D possibly damaging Het
Odaph A G 5: 91,994,890 I104V probably benign Het
Olfr447 A T 6: 42,911,546 I8F possibly damaging Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Phf20 A G 2: 156,307,454 probably benign Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Prex2 C T 1: 11,156,304 H764Y probably benign Het
Rtel1 T C 2: 181,349,934 F375S probably damaging Het
Spanxn4 T C 12: 62,688,197 noncoding transcript Het
Taf1 T C X: 101,544,503 I457T probably benign Het
Tle3 A T 9: 61,407,423 M233L probably benign Het
Trpv3 T C 11: 73,277,823 I72T probably benign Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Xpnpep3 T A 15: 81,427,656 F188I probably benign Het
Zfp69 G A 4: 120,934,475 probably benign Het
Other mutations in Olfr514
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr514 APN 7 108825073 missense probably benign 0.00
IGL01469:Olfr514 APN 7 108825327 missense probably benign 0.29
IGL02079:Olfr514 APN 7 108825936 missense probably damaging 0.99
IGL02330:Olfr514 APN 7 108825999 unclassified probably benign
IGL02662:Olfr514 APN 7 108825745 missense probably benign 0.16
IGL02713:Olfr514 APN 7 108825594 missense probably damaging 1.00
R1158:Olfr514 UTSW 7 108825178 missense probably damaging 1.00
R1610:Olfr514 UTSW 7 108825924 missense probably benign
R1638:Olfr514 UTSW 7 108825235 missense probably benign 0.03
R4630:Olfr514 UTSW 7 108825595 missense probably damaging 1.00
R5042:Olfr514 UTSW 7 108825471 missense possibly damaging 0.72
R5967:Olfr514 UTSW 7 108825714 missense probably benign 0.12
R7180:Olfr514 UTSW 7 108825979 missense probably damaging 0.98
Z1088:Olfr514 UTSW 7 108825896 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGCTGTAGAAGAGGGTGAC -3'
(R):5'- GATCGATTTGCTGCAATCTGC -3'

Sequencing Primer
(F):5'- CACATGTGGAAAAAGCCTTCTGTCTC -3'
(R):5'- GATTTGCTGCAATCTGCTACCC -3'
Posted On2015-06-12