Incidental Mutation 'R4242:Lrmda'
ID320257
Institutional Source Beutler Lab
Gene Symbol Lrmda
Ensembl Gene ENSMUSG00000063458
Gene Nameleucine rich melanocyte differentiation associated
SynonymsOca7, 1700112E06Rik
MMRRC Submission 041059-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4242 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location22019712-23056085 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 22027235 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 13 (Y13*)
Ref Sequence ENSEMBL: ENSMUSP00000124436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075639] [ENSMUST00000159777] [ENSMUST00000161249] [ENSMUST00000162540]
Predicted Effect probably null
Transcript: ENSMUST00000075639
AA Change: Y13*
SMART Domains Protein: ENSMUSP00000075065
Gene: ENSMUSG00000063458
AA Change: Y13*

DomainStartEndE-ValueType
low complexity region 55 82 N/A INTRINSIC
LRRcap 129 147 6.28e-1 SMART
low complexity region 167 184 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159777
AA Change: Y13*
SMART Domains Protein: ENSMUSP00000125751
Gene: ENSMUSG00000063458
AA Change: Y13*

DomainStartEndE-ValueType
SCOP:d1h6ua2 34 109 1e-8 SMART
LRRcap 129 147 6.28e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161249
AA Change: Y13*
SMART Domains Protein: ENSMUSP00000124221
Gene: ENSMUSG00000063458
AA Change: Y13*

DomainStartEndE-ValueType
low complexity region 78 95 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162540
AA Change: Y13*
SMART Domains Protein: ENSMUSP00000124436
Gene: ENSMUSG00000063458
AA Change: Y13*

DomainStartEndE-ValueType
low complexity region 55 82 N/A INTRINSIC
LRRcap 129 147 6.28e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225573
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich repeat protein. The encoded protein is thought to play a role in melanocyte differentiation. Mutations in this gene have been associated with autosomal recessive oculocutaneous albinism 7 (OCA7). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 C T 5: 104,961,213 R406H probably benign Het
Blcap T A 2: 157,560,423 probably benign Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col6a2 C T 10: 76,608,106 probably null Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Dock5 T C 14: 67,828,490 T355A probably benign Het
Dst G A 1: 34,006,216 C148Y possibly damaging Het
Faim2 T A 15: 99,500,201 I289F probably damaging Het
Gm4841 A G 18: 60,270,683 S113P probably benign Het
Heatr5b A G 17: 78,756,922 S1879P probably benign Het
Igll1 C A 16: 16,863,700 G64C probably benign Het
Klhdc7a G A 4: 139,966,721 P305L probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kmt2e T C 5: 23,502,822 probably benign Het
Mad2l1bp T C 17: 46,152,987 E37G possibly damaging Het
Mphosph8 T C 14: 56,674,314 S265P probably benign Het
Mpl T A 4: 118,456,771 D99V probably damaging Het
Notch3 C T 17: 32,143,745 G1302D possibly damaging Het
Odaph A G 5: 91,994,890 I104V probably benign Het
Olfr447 A T 6: 42,911,546 I8F possibly damaging Het
Olfr514 A G 7: 108,825,459 V180A probably benign Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Phf20 A G 2: 156,307,454 probably benign Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Prex2 C T 1: 11,156,304 H764Y probably benign Het
Rtel1 T C 2: 181,349,934 F375S probably damaging Het
Spanxn4 T C 12: 62,688,197 noncoding transcript Het
Taf1 T C X: 101,544,503 I457T probably benign Het
Tle3 A T 9: 61,407,423 M233L probably benign Het
Trpv3 T C 11: 73,277,823 I72T probably benign Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Xpnpep3 T A 15: 81,427,656 F188I probably benign Het
Zfp69 G A 4: 120,934,475 probably benign Het
Other mutations in Lrmda
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Lrmda APN 14 22596517 missense possibly damaging 0.49
IGL01982:Lrmda APN 14 22584482 missense probably damaging 1.00
IGL02792:Lrmda APN 14 22019910 critical splice donor site probably null
IGL02826:Lrmda APN 14 22828737 missense probably damaging 1.00
Bowie UTSW 14 22027235 nonsense probably null
Stardust UTSW 14 22027306 missense probably damaging 1.00
R1921:Lrmda UTSW 14 22577870 missense probably damaging 1.00
R3720:Lrmda UTSW 14 22027331 splice site probably benign
R3722:Lrmda UTSW 14 22027331 splice site probably benign
R5393:Lrmda UTSW 14 22027306 missense probably damaging 1.00
R6562:Lrmda UTSW 14 22598186 intron probably benign
R6749:Lrmda UTSW 14 22027276 missense probably benign 0.02
R7155:Lrmda UTSW 14 22584540 missense probably damaging 1.00
R7560:Lrmda UTSW 14 22828702 missense probably benign 0.15
R7580:Lrmda UTSW 14 22019857 start gained probably benign
R7885:Lrmda UTSW 14 22598320 missense unknown
R7968:Lrmda UTSW 14 22598320 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCTGTCAAGCTCACTGTGAC -3'
(R):5'- CTCAAGATCCTGTAAAGAGCTGGG -3'

Sequencing Primer
(F):5'- TCAAGCTCACTGTGACAGGAAAG -3'
(R):5'- TCCTGTAAAGAGCTGGGACCTATG -3'
Posted On2015-06-12