Incidental Mutation 'R4242:Faim2'
ID320263
Institutional Source Beutler Lab
Gene Symbol Faim2
Ensembl Gene ENSMUSG00000023011
Gene NameFas apoptotic inhibitory molecule 2
Synonymslifeguard, NMP25, Tmbim2, Lfg, 2900002L20Rik
MMRRC Submission 041059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R4242 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99497012-99528165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99500201 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 289 (I289F)
Ref Sequence ENSEMBL: ENSMUSP00000155195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023750] [ENSMUST00000231171]
Predicted Effect probably damaging
Transcript: ENSMUST00000023750
AA Change: I301F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023750
Gene: ENSMUSG00000023011
AA Change: I301F

DomainStartEndE-ValueType
Pfam:Bax1-I 101 312 1.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230837
Predicted Effect probably damaging
Transcript: ENSMUST00000231171
AA Change: I289F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231211
Meta Mutation Damage Score 0.2525 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: A mutation in this gene results in kidney abnormalities including enlargement and dilation. A reduced seizure threshold in response to pharmacological agents is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 C T 5: 104,961,213 R406H probably benign Het
Blcap T A 2: 157,560,423 probably benign Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col6a2 C T 10: 76,608,106 probably null Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Dock5 T C 14: 67,828,490 T355A probably benign Het
Dst G A 1: 34,006,216 C148Y possibly damaging Het
Gm4841 A G 18: 60,270,683 S113P probably benign Het
Heatr5b A G 17: 78,756,922 S1879P probably benign Het
Igll1 C A 16: 16,863,700 G64C probably benign Het
Klhdc7a G A 4: 139,966,721 P305L probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kmt2e T C 5: 23,502,822 probably benign Het
Lrmda C A 14: 22,027,235 Y13* probably null Het
Mad2l1bp T C 17: 46,152,987 E37G possibly damaging Het
Mphosph8 T C 14: 56,674,314 S265P probably benign Het
Mpl T A 4: 118,456,771 D99V probably damaging Het
Notch3 C T 17: 32,143,745 G1302D possibly damaging Het
Odaph A G 5: 91,994,890 I104V probably benign Het
Olfr447 A T 6: 42,911,546 I8F possibly damaging Het
Olfr514 A G 7: 108,825,459 V180A probably benign Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Phf20 A G 2: 156,307,454 probably benign Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Prex2 C T 1: 11,156,304 H764Y probably benign Het
Rtel1 T C 2: 181,349,934 F375S probably damaging Het
Spanxn4 T C 12: 62,688,197 noncoding transcript Het
Taf1 T C X: 101,544,503 I457T probably benign Het
Tle3 A T 9: 61,407,423 M233L probably benign Het
Trpv3 T C 11: 73,277,823 I72T probably benign Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Xpnpep3 T A 15: 81,427,656 F188I probably benign Het
Zfp69 G A 4: 120,934,475 probably benign Het
Other mutations in Faim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Faim2 APN 15 99514433 missense probably damaging 1.00
IGL02820:Faim2 APN 15 99521257 missense probably benign 0.02
IGL02989:Faim2 APN 15 99520362 splice site probably benign
R0827:Faim2 UTSW 15 99524736 missense probably benign
R1171:Faim2 UTSW 15 99500254 missense probably benign 0.05
R1678:Faim2 UTSW 15 99520336 missense possibly damaging 0.92
R1785:Faim2 UTSW 15 99512542 missense probably damaging 1.00
R2004:Faim2 UTSW 15 99500246 missense possibly damaging 0.87
R2063:Faim2 UTSW 15 99514433 missense probably damaging 1.00
R3401:Faim2 UTSW 15 99520348 missense probably damaging 0.98
R4664:Faim2 UTSW 15 99524700 critical splice donor site probably null
R4664:Faim2 UTSW 15 99524701 missense probably benign
R4665:Faim2 UTSW 15 99524700 critical splice donor site probably null
R4665:Faim2 UTSW 15 99524701 missense probably benign
R4719:Faim2 UTSW 15 99527579 critical splice donor site probably null
R4952:Faim2 UTSW 15 99521228 missense possibly damaging 0.51
R5973:Faim2 UTSW 15 99521251 missense probably benign
R7162:Faim2 UTSW 15 99521167 critical splice donor site probably null
R7305:Faim2 UTSW 15 99513933 missense probably damaging 0.99
R7601:Faim2 UTSW 15 99500266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGCATATGTACAAGCTG -3'
(R):5'- TAGTAAACCAGCAGCTTAGCCC -3'

Sequencing Primer
(F):5'- TATGTACAAGCTGCAGAAGGACACC -3'
(R):5'- TAGCCCCTCAGTGTCACAG -3'
Posted On2015-06-12