Mutagenetix > Incidental Mutation

Incidental Mutation 'R4242:Chd1'

320265

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

041059-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4242 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15704967-15772610 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 15770027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 1614 (R1614*)

Ref Sequence

ENSEMBL: ENSMUSP00000024627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024627]

AlphaFold

P40201

Predicted Effect

probably null
Transcript: ENSMUST00000024627
AA Change: R1614*

SMART Domains

Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: R1614*

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1234	1e-112	BLAST
PDB:4B4C\|A	1119	1320	1e-132	PDB
low complexity region	1325	1348	N/A	INTRINSIC
low complexity region	1377	1388	N/A	INTRINSIC
DUF4208	1396	1500	5.54e-51	SMART
low complexity region	1507	1516	N/A	INTRINSIC
low complexity region	1538	1549	N/A	INTRINSIC
low complexity region	1626	1650	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	C	T	5: 104,961,213 (GRCm38)	R406H	probably benign	Het
Blcap	T	A	2: 157,560,423 (GRCm38)		probably benign	Het
Col6a2	C	T	10: 76,608,106 (GRCm38)		probably null	Het
Csnk1e	A	G	15: 79,424,895 (GRCm38)	F277S	probably damaging	Het
Dock5	T	C	14: 67,828,490 (GRCm38)	T355A	probably benign	Het
Dst	G	A	1: 34,006,216 (GRCm38)	C148Y	possibly damaging	Het
Faim2	T	A	15: 99,500,201 (GRCm38)	I289F	probably damaging	Het
Gm4841	A	G	18: 60,270,683 (GRCm38)	S113P	probably benign	Het
Heatr5b	A	G	17: 78,756,922 (GRCm38)	S1879P	probably benign	Het
Igll1	C	A	16: 16,863,700 (GRCm38)	G64C	probably benign	Het
Klhdc7a	G	A	4: 139,966,721 (GRCm38)	P305L	probably benign	Het
Klhl13	T	A	X: 23,315,175 (GRCm38)	D2V	probably damaging	Het
Kmt2e	T	C	5: 23,502,822 (GRCm38)		probably benign	Het
Lrmda	C	A	14: 22,027,235 (GRCm38)	Y13*	probably null	Het
Mad2l1bp	T	C	17: 46,152,987 (GRCm38)	E37G	possibly damaging	Het
Mphosph8	T	C	14: 56,674,314 (GRCm38)	S265P	probably benign	Het
Mpl	T	A	4: 118,456,771 (GRCm38)	D99V	probably damaging	Het
Notch3	C	T	17: 32,143,745 (GRCm38)	G1302D	possibly damaging	Het
Odaph	A	G	5: 91,994,890 (GRCm38)	I104V	probably benign	Het
Or10a48	A	G	7: 108,825,459 (GRCm38)	V180A	probably benign	Het
Or2a25	A	T	6: 42,911,546 (GRCm38)	I8F	possibly damaging	Het
Pde6c	G	A	19: 38,162,845 (GRCm38)	G608S	probably damaging	Het
Phf20	A	G	2: 156,307,454 (GRCm38)		probably benign	Het
Pkdrej	C	T	15: 85,818,144 (GRCm38)	R1197Q	probably damaging	Het
Prex2	C	T	1: 11,156,304 (GRCm38)	H764Y	probably benign	Het
Rtel1	T	C	2: 181,349,934 (GRCm38)	F375S	probably damaging	Het
Spanxn4	T	C	12: 62,688,197 (GRCm38)		noncoding transcript	Het
Taf1	T	C	X: 101,544,503 (GRCm38)	I457T	probably benign	Het
Tle3	A	T	9: 61,407,423 (GRCm38)	M233L	probably benign	Het
Trpv3	T	C	11: 73,277,823 (GRCm38)	I72T	probably benign	Het
Vmn1r237	A	G	17: 21,314,663 (GRCm38)	H216R	possibly damaging	Het
Xpnpep3	T	A	15: 81,427,656 (GRCm38)	F188I	probably benign	Het
Zfp69	G	A	4: 120,934,475 (GRCm38)		probably benign	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15,732,565 (GRCm38)	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15,749,865 (GRCm38)	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15,754,997 (GRCm38)	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17,378,569 (GRCm38)	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15,770,097 (GRCm38)	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17,378,596 (GRCm38)	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15,770,168 (GRCm38)	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15,742,173 (GRCm38)	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17,390,053 (GRCm38)	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15,734,273 (GRCm38)	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15,730,807 (GRCm38)	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15,749,500 (GRCm38)	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15,770,298 (GRCm38)	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15,725,281 (GRCm38)	missense	possibly damaging	0.70
Holly	UTSW	17	15,726,283 (GRCm38)	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15,747,189 (GRCm38)	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15,747,189 (GRCm38)	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17,393,567 (GRCm38)	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15,725,431 (GRCm38)	missense	probably benign
R0285:Chd1	UTSW	17	17,374,680 (GRCm38)	splice site	probably benign
R0326:Chd1	UTSW	17	15,768,568 (GRCm38)	missense	probably benign
R0326:Chd1	UTSW	17	15,768,566 (GRCm38)	missense	probably damaging	1.00
R0372:Chd1	UTSW	17	17,387,290 (GRCm38)	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15,749,894 (GRCm38)	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15,734,342 (GRCm38)	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15,742,288 (GRCm38)	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15,758,261 (GRCm38)	unclassified	probably benign
R0701:Chd1	UTSW	17	15,725,431 (GRCm38)	missense	probably benign
R0788:Chd1	UTSW	17	15,707,114 (GRCm38)	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15,770,241 (GRCm38)	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15,725,431 (GRCm38)	missense	probably benign
R1169:Chd1	UTSW	17	15,735,732 (GRCm38)	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15,725,312 (GRCm38)	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17,387,480 (GRCm38)	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15,726,283 (GRCm38)	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15,726,283 (GRCm38)	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15,739,507 (GRCm38)	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15,743,232 (GRCm38)	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17,387,271 (GRCm38)	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15,770,303 (GRCm38)	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15,762,486 (GRCm38)	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15,731,006 (GRCm38)	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15,742,294 (GRCm38)	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17,374,651 (GRCm38)	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17,374,651 (GRCm38)	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15,731,871 (GRCm38)	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15,770,027 (GRCm38)	nonsense	probably null
R4354:Chd1	UTSW	17	17,390,001 (GRCm38)	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15,760,395 (GRCm38)	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15,760,395 (GRCm38)	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17,377,817 (GRCm38)	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15,733,124 (GRCm38)	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15,768,754 (GRCm38)	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15,768,753 (GRCm38)	nonsense	probably null
R4880:Chd1	UTSW	17	17,374,654 (GRCm38)	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15,742,231 (GRCm38)	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15,762,405 (GRCm38)	missense	probably benign
R5078:Chd1	UTSW	17	15,726,354 (GRCm38)	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15,728,198 (GRCm38)	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15,735,743 (GRCm38)	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15,770,268 (GRCm38)	missense	possibly damaging	0.55
R5304:Chd1	UTSW	17	15,754,951 (GRCm38)	missense	probably benign	0.01
R5307:Chd1	UTSW	17	15,732,570 (GRCm38)	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15,738,549 (GRCm38)	missense	probably damaging	1.00
R5553:Chd1	UTSW	17	17,385,613 (GRCm38)	missense	probably benign	0.17
R5623:Chd1	UTSW	17	15,754,932 (GRCm38)	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17,377,773 (GRCm38)	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15,758,688 (GRCm38)	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15,730,203 (GRCm38)	splice site	probably null
R6373:Chd1	UTSW	17	15,738,636 (GRCm38)	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15,730,602 (GRCm38)	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17,380,988 (GRCm38)	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15,738,633 (GRCm38)	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15,725,430 (GRCm38)	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17,387,167 (GRCm38)	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15,761,366 (GRCm38)	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15,706,937 (GRCm38)	splice site	probably null
R7317:Chd1	UTSW	17	15,742,274 (GRCm38)	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15,770,237 (GRCm38)	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15,749,398 (GRCm38)	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15,767,475 (GRCm38)	missense	probably benign
R7763:Chd1	UTSW	17	15,733,041 (GRCm38)	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15,761,404 (GRCm38)	missense	probably benign
R8194:Chd1	UTSW	17	17,374,475 (GRCm38)	start gained	probably benign
R8261:Chd1	UTSW	17	17,387,542 (GRCm38)	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15,769,980 (GRCm38)	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15,743,211 (GRCm38)	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15,762,449 (GRCm38)	missense	probably damaging	0.98
R9067:Chd1	UTSW	17	15,730,845 (GRCm38)	missense	possibly damaging	0.49
R9184:Chd1	UTSW	17	15,742,289 (GRCm38)	missense	possibly damaging	0.71
R9210:Chd1	UTSW	17	15,730,505 (GRCm38)	missense	possibly damaging	0.70
R9212:Chd1	UTSW	17	15,730,505 (GRCm38)	missense	possibly damaging	0.70
R9666:Chd1	UTSW	17	15,735,714 (GRCm38)	missense	probably damaging	1.00
R9673:Chd1	UTSW	17	15,768,761 (GRCm38)	missense	probably benign	0.24
Z1176:Chd1	UTSW	17	15,768,733 (GRCm38)	missense	probably damaging	1.00
Z1176:Chd1	UTSW	17	15,766,347 (GRCm38)	missense	probably damaging	0.98
Z1177:Chd1	UTSW	17	15,747,801 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGTTCTCAGCTACTTTCAGG -3'
(R):5'- ATCTAAAGGTGACCTAGGGCCAC -3'

Sequencing Primer
(F):5'- AGGAAACTGTGAGCTTCTGC -3'
(R):5'- TGACCTAGGGCCACTGCTG -3'

Posted On

2015-06-12