Mutagenetix > Incidental Mutation

Incidental Mutation 'R0396:Kdr'

32027

Institutional Source

Beutler Lab

Gene Symbol

Kdr

Ensembl Gene

ENSMUSG00000062960

Gene Name

kinase insert domain protein receptor

Synonyms

Flk1, vascular endothelial growth factor receptor- 2, VEGF receptor-2, VEGFR2, VEGFR-2, Flk-1

MMRRC Submission

038602-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0396 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75932827-75978458 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75960728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 541 (I541V)

Ref Sequence

ENSEMBL: ENSMUSP00000109144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113516]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113516
AA Change: I541V

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000109144
Gene: ENSMUSG00000062960
AA Change: I541V

Domain	Start	End	E-Value	Type
IG	38	121	2.43e-2	SMART
IG_like	137	220	5.91e1	SMART
IG	233	327	2.64e-12	SMART
IG	339	420	1.2e-6	SMART
IG	432	546	2.14e0	SMART
IG	554	657	2.79e-2	SMART
IGc2	677	742	8.42e-20	SMART
TyrKc	832	1158	7.07e-138	SMART
low complexity region	1310	1315	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202473

Meta Mutation Damage Score

0.0970

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 89.8%

Validation Efficiency

92% (96/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vascular endothelial growth factor (VEGF) is a major growth factor for endothelial cells. This gene encodes one of the two receptors of the VEGF. This receptor, known as kinase insert domain receptor, is a type III receptor tyrosine kinase. It functions as the main mediator of VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting. The signalling and trafficking of this receptor are regulated by multiple factors, including Rab GTPase, P2Y purine nucleotide receptor, integrin alphaVbeta3, T-cell protein tyrosine phosphatase, etc.. Mutations of this gene are implicated in infantile capillary hemangiomas. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mice die at early embryonic stages due to failure of blood vessel formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,377	V467A	possibly damaging	Het
4933405L10Rik	G	A	8: 105,709,780	V194I	probably benign	Het
Acsm1	A	T	7: 119,636,455	I133F	probably damaging	Het
Adamts9	T	A	6: 92,798,005	T1676S	probably benign	Het
Adcy4	T	C	14: 55,772,288	D769G	probably benign	Het
Aif1	T	C	17: 35,171,109	*148W	probably null	Het
Akna	C	T	4: 63,392,126		probably benign	Het
Arhgap32	G	A	9: 32,245,255		probably null	Het
Atpaf1	G	A	4: 115,785,252	E92K	possibly damaging	Het
C1s1	T	C	6: 124,533,354	E378G	probably benign	Het
Caprin1	T	A	2: 103,769,569	Q108L	probably damaging	Het
Car13	A	T	3: 14,656,239	H154L	probably benign	Het
Cdon	C	A	9: 35,470,130	N605K	probably damaging	Het
Ceacam10	G	A	7: 24,781,014	G70E	probably damaging	Het
Cfap221	G	A	1: 119,954,200	T286M	probably benign	Het
Cfap61	T	C	2: 145,949,944	F107S	possibly damaging	Het
Coil	C	A	11: 88,981,623	T270N	probably benign	Het
Crocc2	T	G	1: 93,224,214		probably benign	Het
Crot	T	C	5: 8,969,959	E461G	probably damaging	Het
D130052B06Rik	G	T	11: 33,623,391	R41L	unknown	Het
D630045J12Rik	T	C	6: 38,196,736	S166G	possibly damaging	Het
Dennd4a	T	G	9: 64,862,391	V460G	probably damaging	Het
Depdc7	A	T	2: 104,727,323		probably benign	Het
Dgkb	G	A	12: 38,190,135		probably null	Het
Dhx57	T	G	17: 80,274,797	S407R	probably benign	Het
Dnase2a	G	T	8: 84,909,763		probably benign	Het
Dqx1	T	G	6: 83,059,005	M106R	probably benign	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Ephx2	T	G	14: 66,108,063	I151L	probably benign	Het
Gdf3	C	T	6: 122,607,135	G91D	probably damaging	Het
Gm14124	G	A	2: 150,268,053	G221D	probably damaging	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gsdme	T	A	6: 50,221,107	H291L	probably benign	Het
H2-Bl	A	G	17: 36,083,722	I103T	possibly damaging	Het
Hif3a	G	A	7: 17,052,021		probably benign	Het
Hmox2	A	T	16: 4,765,763	I232L	probably benign	Het
Itgb2	A	G	10: 77,561,189	Y686C	probably damaging	Het
Jmjd1c	A	G	10: 67,219,523	T528A	possibly damaging	Het
Khdrbs2	C	A	1: 32,519,973	V343L	probably damaging	Het
Kif16b	C	T	2: 142,853,659	R175H	probably damaging	Het
Klri2	T	G	6: 129,740,288	E44A	possibly damaging	Het
Kmt2b	G	T	7: 30,576,755	T1773K	probably damaging	Het
Lair1	A	G	7: 4,010,786	L154P	probably damaging	Het
Larp1b	G	A	3: 40,970,561	V158M	probably damaging	Het
Lgi3	T	A	14: 70,534,840	I275N	probably damaging	Het
Lrba	A	G	3: 86,295,179	N246D	probably damaging	Het
Lrrc45	T	A	11: 120,714,907		probably benign	Het
Mdh2	G	T	5: 135,789,679	V263L	probably benign	Het
Myom1	T	A	17: 71,034,693	V149E	probably damaging	Het
Nanos1	A	T	19: 60,757,041	D259V	probably damaging	Het
Nedd4l	T	A	18: 65,161,654		probably benign	Het
Npas3	A	G	12: 53,831,745	Y150C	probably damaging	Het
Olfr1066	T	C	2: 86,456,019	N84S	possibly damaging	Het
Olfr1129	T	A	2: 87,575,567	V161D	possibly damaging	Het
Olfr1392	A	T	11: 49,293,338	I6F	probably benign	Het
Olfr479	A	T	7: 108,055,963	H327L	probably benign	Het
Olfr672	G	A	7: 104,996,706	A66V	probably damaging	Het
Olfr93	C	T	17: 37,151,555	C139Y	probably damaging	Het
Pde4c	A	G	8: 70,750,076	N637S	probably benign	Het
Pds5b	T	A	5: 150,779,275	V824D	possibly damaging	Het
Pole2	A	T	12: 69,222,386		probably benign	Het
Ppig	C	T	2: 69,735,976		probably benign	Het
Prep	A	G	10: 45,092,676	Y90C	probably damaging	Het
Proca1	A	T	11: 78,194,905	R11S	probably damaging	Het
Prph	T	A	15: 99,056,991	W313R	probably benign	Het
Prune2	C	T	19: 17,123,080	P1983S	probably benign	Het
Ptbp2	G	A	3: 119,724,198		probably benign	Het
Rsph6a	C	T	7: 19,074,106	P398L	probably damaging	Het
Sdk2	T	C	11: 113,829,967	I1379V	probably benign	Het
Sf3b1	C	T	1: 55,019,271	G53E	probably damaging	Het
Slc9a3	T	C	13: 74,157,784		probably null	Het
Smarcal1	A	T	1: 72,626,473	H710L	probably benign	Het
Soat2	GAGAAG	GAG	15: 102,150,707		probably benign	Het
Sptan1	T	C	2: 29,991,033	V438A	probably damaging	Het
Sstr4	T	A	2: 148,396,261	V264D	probably damaging	Het
Susd2	A	G	10: 75,639,911	L418P	probably damaging	Het
Synj1	A	G	16: 90,938,640	V1475A	probably benign	Het
Szt2	G	A	4: 118,376,347		probably benign	Het
Tbc1d4	T	C	14: 101,458,063		probably null	Het
Tesk1	A	G	4: 43,446,000	E311G	probably damaging	Het
Tmed5	A	T	5: 108,126,016	V119E	probably damaging	Het
Tmem260	T	C	14: 48,486,867	S201P	possibly damaging	Het
Tnxb	A	G	17: 34,671,733	Y350C	probably damaging	Het
Tpte	T	C	8: 22,335,608		probably benign	Het
Trim37	A	T	11: 87,146,968	D161V	probably damaging	Het
Trrap	C	A	5: 144,814,556	Q1640K	probably damaging	Het
Tspoap1	T	C	11: 87,776,346		probably benign	Het
Ttk	T	A	9: 83,847,260		probably benign	Het
Vmn1r172	A	G	7: 23,660,532	S281G	probably benign	Het
Vmn1r177	A	G	7: 23,865,597	S285P	probably damaging	Het
Vmn1r231	C	T	17: 20,890,399	V85I	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r118	T	C	17: 55,608,643	I436V	probably benign	Het
Vmn2r12	T	C	5: 109,092,899	K116R	probably benign	Het
Vmn2r28	T	A	7: 5,488,514	I245L	probably benign	Het
Wdr26	A	T	1: 181,180,651		probably benign	Het
Xrcc3	A	T	12: 111,809,957	H67Q	probably benign	Het
Zbbx	A	T	3: 75,078,495	S417T	possibly damaging	Het
Zc3h13	A	G	14: 75,323,482	D504G	unknown	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zyg11b	A	T	4: 108,255,308	F388I	probably damaging	Het

Other mutations in Kdr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Kdr	APN	5	75968750	missense	probably damaging	1.00
IGL01094:Kdr	APN	5	75961760	missense	probably benign	0.00
IGL01310:Kdr	APN	5	75949601	missense	probably damaging	1.00
IGL01689:Kdr	APN	5	75936840	missense	probably benign	0.01
IGL01986:Kdr	APN	5	75952859	missense	probably benign	0.18
IGL02065:Kdr	APN	5	75961853	splice site	probably benign
IGL02200:Kdr	APN	5	75950102	splice site	probably benign
IGL02272:Kdr	APN	5	75961840	missense	probably benign
IGL02426:Kdr	APN	5	75974466	missense	probably benign	0.00
IGL02483:Kdr	APN	5	75936294	critical splice donor site	probably null
IGL02543:Kdr	APN	5	75964947	splice site	probably benign
IGL02590:Kdr	APN	5	75936323	missense	probably benign	0.00
IGL03204:Kdr	APN	5	75972382	missense	possibly damaging	0.96
IGL03228:Kdr	APN	5	75957048	missense	probably damaging	0.97
IGL03265:Kdr	APN	5	75960773	missense	probably damaging	1.00
engelein	UTSW	5	75952889	missense	probably damaging	1.00
PIT4131001:Kdr	UTSW	5	75941971	splice site	probably benign
PIT4519001:Kdr	UTSW	5	75936896	missense	possibly damaging	0.86
R0133:Kdr	UTSW	5	75951838	missense	probably damaging	1.00
R0197:Kdr	UTSW	5	75968422	missense	possibly damaging	0.82
R0282:Kdr	UTSW	5	75950100	splice site	probably benign
R0309:Kdr	UTSW	5	75946927	splice site	probably benign
R0371:Kdr	UTSW	5	75941834	missense	probably benign	0.22
R0498:Kdr	UTSW	5	75959138	missense	probably benign	0.00
R0932:Kdr	UTSW	5	75968805	missense	probably benign	0.02
R1077:Kdr	UTSW	5	75956231	missense	probably damaging	1.00
R1183:Kdr	UTSW	5	75946851	missense	probably damaging	1.00
R1713:Kdr	UTSW	5	75968467	missense	probably benign	0.03
R1853:Kdr	UTSW	5	75952905	missense	possibly damaging	0.67
R1854:Kdr	UTSW	5	75952905	missense	possibly damaging	0.67
R2142:Kdr	UTSW	5	75968423	missense	possibly damaging	0.56
R2238:Kdr	UTSW	5	75949519	missense	possibly damaging	0.78
R2891:Kdr	UTSW	5	75946836	missense	probably damaging	1.00
R2893:Kdr	UTSW	5	75946836	missense	probably damaging	1.00
R2894:Kdr	UTSW	5	75946836	missense	probably damaging	1.00
R2903:Kdr	UTSW	5	75966409	missense	probably damaging	1.00
R2904:Kdr	UTSW	5	75966409	missense	probably damaging	1.00
R3155:Kdr	UTSW	5	75968405	missense	probably benign	0.02
R3939:Kdr	UTSW	5	75972429	nonsense	probably null
R4051:Kdr	UTSW	5	75968408	missense	probably benign
R4151:Kdr	UTSW	5	75957101	missense	possibly damaging	0.94
R4433:Kdr	UTSW	5	75943925	missense	possibly damaging	0.61
R4687:Kdr	UTSW	5	75968792	missense	possibly damaging	0.81
R4691:Kdr	UTSW	5	75944599	missense	possibly damaging	0.79
R5185:Kdr	UTSW	5	75952417	splice site	probably null
R5544:Kdr	UTSW	5	75960743	nonsense	probably null
R6083:Kdr	UTSW	5	75944366	missense	probably damaging	1.00
R6477:Kdr	UTSW	5	75968841	missense	probably benign	0.02
R6568:Kdr	UTSW	5	75961774	missense	probably benign	0.01
R6647:Kdr	UTSW	5	75952889	missense	probably damaging	1.00
R6827:Kdr	UTSW	5	75944545	missense	probably damaging	1.00
R6887:Kdr	UTSW	5	75968451	missense	probably benign	0.00
R6929:Kdr	UTSW	5	75978104	missense	probably benign	0.16
R6993:Kdr	UTSW	5	75972411	missense	probably benign
R7022:Kdr	UTSW	5	75972260	nonsense	probably null
R7050:Kdr	UTSW	5	75950120	missense	probably damaging	1.00
R7099:Kdr	UTSW	5	75944333	missense	probably damaging	0.98
R7274:Kdr	UTSW	5	75964700	missense	probably benign	0.00
R7310:Kdr	UTSW	5	75944325	missense	probably damaging	0.99
R7565:Kdr	UTSW	5	75948843	missense	probably damaging	0.97
R9067:Kdr	UTSW	5	75948768	missense	probably damaging	1.00
R9448:Kdr	UTSW	5	75941909	missense	probably benign	0.03
R9564:Kdr	UTSW	5	75964905	missense	probably benign	0.00
R9655:Kdr	UTSW	5	75961828	missense	probably benign
R9691:Kdr	UTSW	5	75968861	missense	probably damaging	1.00
R9799:Kdr	UTSW	5	75957092	missense	possibly damaging	0.72
X0024:Kdr	UTSW	5	75974406	missense	probably damaging	1.00
Z1177:Kdr	UTSW	5	75968475	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- AGCACAAGTGGAAACCTTCTCTGAC -3'
(R):5'- TGGCAAAGGCAGTTCTTAGCAGC -3'

Sequencing Primer
(F):5'- GGAAACCTTCTCTGACCAGTGATAG -3'
(R):5'- GGTCAGTCTCAgtgtgtgtg -3'

Posted On

2013-04-24