Incidental Mutation 'R4242:Klhl13'
ID320272
Institutional Source Beutler Lab
Gene Symbol Klhl13
Ensembl Gene ENSMUSG00000036782
Gene Namekelch-like 13
SynonymsD130072F20Rik, Bklhd2, 1200009K10Rik
MMRRC Submission 041059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R4242 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location23219271-23365082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23315175 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 2 (D2V)
Ref Sequence ENSEMBL: ENSMUSP00000041190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035973] [ENSMUST00000115313]
Predicted Effect probably damaging
Transcript: ENSMUST00000035973
AA Change: D2V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041190
Gene: ENSMUSG00000036782
AA Change: D2V

DomainStartEndE-ValueType
BTB 75 174 6.43e-19 SMART
BACK 179 280 5.87e-26 SMART
Kelch 324 372 4.58e-3 SMART
Kelch 373 424 1.38e-6 SMART
Kelch 425 471 6.71e-10 SMART
Kelch 472 518 3.68e-7 SMART
Kelch 519 570 1.69e-6 SMART
Kelch 571 619 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115313
SMART Domains Protein: ENSMUSP00000110968
Gene: ENSMUSG00000036782

DomainStartEndE-ValueType
BTB 41 140 6.43e-19 SMART
BACK 145 246 5.87e-26 SMART
Kelch 290 338 4.58e-3 SMART
Kelch 339 390 1.38e-6 SMART
Kelch 391 437 6.71e-10 SMART
Kelch 438 484 3.68e-7 SMART
Kelch 485 536 1.69e-6 SMART
Kelch 537 585 1.25e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153345
Meta Mutation Damage Score 0.1837 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a BTB and kelch domain containing protein and belongs to the kelch repeat domain containing superfamily of proteins. The encoded protein functions as an adaptor protein that complexes with Cullin 3 and other proteins to form the Cullin 3-based E3 ubiquitin-protein ligase complex. This complex is necessary for proper chromosome segregation and completion of cytokinesis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 C T 5: 104,961,213 R406H probably benign Het
Blcap T A 2: 157,560,423 probably benign Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col6a2 C T 10: 76,608,106 probably null Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Dock5 T C 14: 67,828,490 T355A probably benign Het
Dst G A 1: 34,006,216 C148Y possibly damaging Het
Faim2 T A 15: 99,500,201 I289F probably damaging Het
Gm4841 A G 18: 60,270,683 S113P probably benign Het
Heatr5b A G 17: 78,756,922 S1879P probably benign Het
Igll1 C A 16: 16,863,700 G64C probably benign Het
Klhdc7a G A 4: 139,966,721 P305L probably benign Het
Kmt2e T C 5: 23,502,822 probably benign Het
Lrmda C A 14: 22,027,235 Y13* probably null Het
Mad2l1bp T C 17: 46,152,987 E37G possibly damaging Het
Mphosph8 T C 14: 56,674,314 S265P probably benign Het
Mpl T A 4: 118,456,771 D99V probably damaging Het
Notch3 C T 17: 32,143,745 G1302D possibly damaging Het
Odaph A G 5: 91,994,890 I104V probably benign Het
Olfr447 A T 6: 42,911,546 I8F possibly damaging Het
Olfr514 A G 7: 108,825,459 V180A probably benign Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Phf20 A G 2: 156,307,454 probably benign Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Prex2 C T 1: 11,156,304 H764Y probably benign Het
Rtel1 T C 2: 181,349,934 F375S probably damaging Het
Spanxn4 T C 12: 62,688,197 noncoding transcript Het
Taf1 T C X: 101,544,503 I457T probably benign Het
Tle3 A T 9: 61,407,423 M233L probably benign Het
Trpv3 T C 11: 73,277,823 I72T probably benign Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Xpnpep3 T A 15: 81,427,656 F188I probably benign Het
Zfp69 G A 4: 120,934,475 probably benign Het
Other mutations in Klhl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1951:Klhl13 UTSW X 23261581 splice site probably benign
R3698:Klhl13 UTSW X 23248183 missense probably benign 0.06
R3873:Klhl13 UTSW X 23285176 missense probably benign 0.06
R3874:Klhl13 UTSW X 23285176 missense probably benign 0.06
R4241:Klhl13 UTSW X 23315175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCACTAGCTCAGAACACAGTATCAC -3'
(R):5'- GCACATGTTATCTAACGGTTTCACATG -3'

Sequencing Primer
(F):5'- CTGATTAGACAGTTCTTCTCT -3'
(R):5'- TGCTATTTAGTGATTCACCATTGTG -3'
Posted On2015-06-12