Incidental Mutation 'R4243:Zbtb40'
ID320289
Institutional Source Beutler Lab
Gene Symbol Zbtb40
Ensembl Gene ENSMUSG00000060862
Gene Namezinc finger and BTB domain containing 40
Synonyms
MMRRC Submission 041643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4243 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136979732-137048801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137018549 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 58 (A58T)
Ref Sequence ENSEMBL: ENSMUSP00000061899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049583]
Predicted Effect probably benign
Transcript: ENSMUST00000049583
AA Change: A58T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000061899
Gene: ENSMUSG00000060862
AA Change: A58T

DomainStartEndE-ValueType
low complexity region 8 14 N/A INTRINSIC
BTB 24 117 3.39e-18 SMART
low complexity region 150 170 N/A INTRINSIC
low complexity region 525 533 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
ZnF_C2H2 754 774 4.86e1 SMART
low complexity region 786 801 N/A INTRINSIC
ZnF_C2H2 825 848 1.16e-1 SMART
ZnF_C2H2 854 876 1.1e-2 SMART
ZnF_C2H2 882 905 1.16e-1 SMART
ZnF_C2H2 911 933 1.2e-3 SMART
ZnF_C2H2 939 962 8.81e-2 SMART
ZnF_C2H2 969 992 7.05e-1 SMART
ZnF_C2H2 997 1019 1.47e-3 SMART
ZnF_C2H2 1025 1047 2.86e-1 SMART
ZnF_C2H2 1065 1088 6.67e-2 SMART
ZnF_C2H2 1094 1117 6.23e-2 SMART
ZnF_C2H2 1123 1146 1.53e-1 SMART
ZnF_C2H2 1154 1177 1.56e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145505
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik C A 5: 114,813,794 R40L possibly damaging Het
4930449A18Rik T A 3: 59,825,782 noncoding transcript Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
4933409G03Rik C T 2: 68,593,543 probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Birc2 T C 9: 7,834,385 T32A probably benign Het
Cdh13 T A 8: 119,242,257 V451E probably damaging Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Cdt1 A G 8: 122,571,418 M383V probably benign Het
Chrna9 T C 5: 65,935,036 probably null Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cspg4 T C 9: 56,887,857 S959P probably benign Het
Ctbp2 A G 7: 132,998,854 I647T probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Ddx1 A T 12: 13,240,909 C68* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dynlt1b T C 17: 6,430,240 probably null Het
Faxc G A 4: 21,982,491 R310Q probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Frmd5 C A 2: 121,562,882 probably null Het
Gm5174 C A 10: 86,656,280 noncoding transcript Het
Hspa12b C T 2: 131,141,858 H293Y possibly damaging Het
Jakmip2 A G 18: 43,577,436 V234A probably benign Het
Jkamp G A 12: 72,094,025 V108I probably benign Het
Mettl23 T C 11: 116,848,300 V72A possibly damaging Het
Morc2b T A 17: 33,136,401 Y799F probably benign Het
Mtmr11 T A 3: 96,168,077 C358S probably damaging Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Mysm1 A G 4: 94,969,011 V120A probably benign Het
Nhlrc1 C T 13: 47,014,026 V252I probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Olfr530 G A 7: 140,372,944 A222V probably benign Het
Olfr855 C A 9: 19,584,558 T7K probably damaging Het
Pard3 G A 8: 127,371,647 A390T probably benign Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Phactr3 G A 2: 178,283,189 probably null Het
Pkn2 T C 3: 142,820,578 N413D possibly damaging Het
Ppp1r12b T G 1: 134,782,108 probably benign Het
Ptprf A G 4: 118,226,452 probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rasa1 A G 13: 85,244,195 Y407H probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Slc27a1 A G 8: 71,584,973 T535A probably benign Het
Stra6 G A 9: 58,143,026 A237T probably benign Het
Tor1aip2 A G 1: 156,065,436 E496G probably damaging Het
Usp47 A G 7: 112,108,629 D1294G probably damaging Het
Utp20 A G 10: 88,807,325 probably null Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zfhx3 A G 8: 108,792,320 T25A probably damaging Het
Other mutations in Zbtb40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zbtb40 APN 4 136987340 missense probably damaging 0.99
IGL00573:Zbtb40 APN 4 137018078 missense probably benign 0.00
IGL00774:Zbtb40 APN 4 136994524 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0334:Zbtb40 UTSW 4 136986556 missense probably damaging 1.00
R0393:Zbtb40 UTSW 4 137018531 missense probably benign 0.09
R0482:Zbtb40 UTSW 4 136983228 missense probably damaging 1.00
R1457:Zbtb40 UTSW 4 136984837 missense possibly damaging 0.81
R1846:Zbtb40 UTSW 4 137007839 missense probably benign 0.00
R2153:Zbtb40 UTSW 4 136991635 missense probably damaging 1.00
R2206:Zbtb40 UTSW 4 137017285 nonsense probably null
R2291:Zbtb40 UTSW 4 136985017 missense possibly damaging 0.78
R2406:Zbtb40 UTSW 4 136998568 missense probably benign 0.34
R3707:Zbtb40 UTSW 4 136999568 missense probably damaging 1.00
R4131:Zbtb40 UTSW 4 136995396 missense probably benign 0.00
R4424:Zbtb40 UTSW 4 136998694 missense probably damaging 0.96
R4725:Zbtb40 UTSW 4 137018761 utr 5 prime probably benign
R4784:Zbtb40 UTSW 4 137007097 missense probably damaging 1.00
R4795:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4796:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4838:Zbtb40 UTSW 4 137001216 missense probably benign 0.15
R4859:Zbtb40 UTSW 4 136988759 missense probably damaging 0.98
R4883:Zbtb40 UTSW 4 137000930 missense probably benign 0.09
R5001:Zbtb40 UTSW 4 136996150 missense probably damaging 1.00
R5030:Zbtb40 UTSW 4 136997952 missense probably benign 0.00
R5060:Zbtb40 UTSW 4 137001293 missense possibly damaging 0.71
R5529:Zbtb40 UTSW 4 136983163 missense possibly damaging 0.90
R5536:Zbtb40 UTSW 4 136987331 missense probably damaging 1.00
R5589:Zbtb40 UTSW 4 136995283 missense probably damaging 1.00
R6114:Zbtb40 UTSW 4 136988691 missense probably damaging 1.00
R6393:Zbtb40 UTSW 4 136984866 missense probably null
R7208:Zbtb40 UTSW 4 136999626 splice site probably null
R7406:Zbtb40 UTSW 4 137000894 missense probably benign 0.29
R7722:Zbtb40 UTSW 4 136991518 missense probably damaging 0.98
R7803:Zbtb40 UTSW 4 137017327 missense probably benign
R8292:Zbtb40 UTSW 4 136999567 missense probably damaging 1.00
R8735:Zbtb40 UTSW 4 136998646 missense probably damaging 1.00
R8890:Zbtb40 UTSW 4 136998586 missense probably damaging 1.00
RF014:Zbtb40 UTSW 4 137017306 missense probably benign 0.20
Z1176:Zbtb40 UTSW 4 136995463 missense probably damaging 1.00
Z1177:Zbtb40 UTSW 4 137018024 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGGACAGCACTGAGACATC -3'
(R):5'- ATGGAACTCCCCAGCTACAG -3'

Sequencing Primer
(F):5'- CCTGGACAGAGCAGTTTACCAG -3'
(R):5'- CAGCTACAGCCAGCAGC -3'
Posted On2015-06-12