Mutagenetix > Incidental Mutations

Incidental Mutation 'R0396:Trrap'

32031

Institutional Source

Beutler Lab

Gene Symbol

Trrap

Ensembl Gene

ENSMUSG00000045482

Gene Name

transformation/transcription domain-associated protein

Synonyms

transactivation/transformation-domain associated protein

MMRRC Submission

038602-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0396 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144767732-144859778 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 144814556 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 1640 (Q1640K)

Ref Sequence

ENSEMBL: ENSMUSP00000148419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000038980
AA Change: Q1621K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: Q1621K

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3363	3376	N/A	INTRINSIC
low complexity region	3407	3418	N/A	INTRINSIC
PI3Kc	3509	3798	5.11e-8	SMART
FATC	3797	3829	1.89e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094120
AA Change: Q1639K

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: Q1639K

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1682	2e-6	SMART
low complexity region	1850	1861	N/A	INTRINSIC
low complexity region	1884	1899	N/A	INTRINSIC
low complexity region	2307	2321	N/A	INTRINSIC
Pfam:FAT	2848	3203	1.1e-68	PFAM
low complexity region	3392	3405	N/A	INTRINSIC
low complexity region	3436	3447	N/A	INTRINSIC
PI3Kc	3538	3827	5.11e-8	SMART
FATC	3826	3858	1.89e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100467
AA Change: Q1621K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: Q1621K

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3381	3394	N/A	INTRINSIC
low complexity region	3425	3436	N/A	INTRINSIC
PI3Kc	3527	3816	5.11e-8	SMART
FATC	3815	3847	1.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132347

Predicted Effect

unknown
Transcript: ENSMUST00000132925
AA Change: Q1360K

SMART Domains

Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: Q1360K

Domain	Start	End	E-Value	Type
low complexity region	197	242	N/A	INTRINSIC
low complexity region	244	255	N/A	INTRINSIC
SCOP:d1gw5a_	474	1003	9e-7	SMART
Blast:PI3Kc	480	579	1e-13	BLAST
low complexity region	1083	1092	N/A	INTRINSIC
low complexity region	1572	1583	N/A	INTRINSIC
low complexity region	1606	1621	N/A	INTRINSIC
low complexity region	2029	2043	N/A	INTRINSIC
Pfam:FAT	2570	2914	1.5e-69	PFAM
low complexity region	3121	3134	N/A	INTRINSIC
low complexity region	3165	3176	N/A	INTRINSIC
PI3Kc	3267	3556	5.11e-8	SMART
FATC	3555	3587	1.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197834

Predicted Effect

probably damaging
Transcript: ENSMUST00000213013
AA Change: Q1640K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.7140

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 89.8%

Validation Efficiency

92% (96/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,377	V467A	possibly damaging	Het
4933405L10Rik	G	A	8: 105,709,780	V194I	probably benign	Het
Acsm1	A	T	7: 119,636,455	I133F	probably damaging	Het
Adamts9	T	A	6: 92,798,005	T1676S	probably benign	Het
Adcy4	T	C	14: 55,772,288	D769G	probably benign	Het
Aif1	T	C	17: 35,171,109	*148W	probably null	Het
Akna	C	T	4: 63,392,126		probably benign	Het
Arhgap32	G	A	9: 32,245,255		probably null	Het
Atpaf1	G	A	4: 115,785,252	E92K	possibly damaging	Het
C1s1	T	C	6: 124,533,354	E378G	probably benign	Het
Caprin1	T	A	2: 103,769,569	Q108L	probably damaging	Het
Car13	A	T	3: 14,656,239	H154L	probably benign	Het
Cdon	C	A	9: 35,470,130	N605K	probably damaging	Het
Ceacam10	G	A	7: 24,781,014	G70E	probably damaging	Het
Cfap221	G	A	1: 119,954,200	T286M	probably benign	Het
Cfap61	T	C	2: 145,949,944	F107S	possibly damaging	Het
Coil	C	A	11: 88,981,623	T270N	probably benign	Het
Crocc2	T	G	1: 93,224,214		probably benign	Het
Crot	T	C	5: 8,969,959	E461G	probably damaging	Het
D130052B06Rik	G	T	11: 33,623,391	R41L	unknown	Het
D630045J12Rik	T	C	6: 38,196,736	S166G	possibly damaging	Het
Dennd4a	T	G	9: 64,862,391	V460G	probably damaging	Het
Depdc7	A	T	2: 104,727,323		probably benign	Het
Dgkb	G	A	12: 38,190,135		probably null	Het
Dhx57	T	G	17: 80,274,797	S407R	probably benign	Het
Dnase2a	G	T	8: 84,909,763		probably benign	Het
Dqx1	T	G	6: 83,059,005	M106R	probably benign	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Ephx2	T	G	14: 66,108,063	I151L	probably benign	Het
Gdf3	C	T	6: 122,607,135	G91D	probably damaging	Het
Gm14124	G	A	2: 150,268,053	G221D	probably damaging	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gsdme	T	A	6: 50,221,107	H291L	probably benign	Het
H2-Bl	A	G	17: 36,083,722	I103T	possibly damaging	Het
Hif3a	G	A	7: 17,052,021		probably benign	Het
Hmox2	A	T	16: 4,765,763	I232L	probably benign	Het
Itgb2	A	G	10: 77,561,189	Y686C	probably damaging	Het
Jmjd1c	A	G	10: 67,219,523	T528A	possibly damaging	Het
Kdr	T	C	5: 75,960,728	I541V	possibly damaging	Het
Khdrbs2	C	A	1: 32,519,973	V343L	probably damaging	Het
Kif16b	C	T	2: 142,853,659	R175H	probably damaging	Het
Klri2	T	G	6: 129,740,288	E44A	possibly damaging	Het
Kmt2b	G	T	7: 30,576,755	T1773K	probably damaging	Het
Lair1	A	G	7: 4,010,786	L154P	probably damaging	Het
Larp1b	G	A	3: 40,970,561	V158M	probably damaging	Het
Lgi3	T	A	14: 70,534,840	I275N	probably damaging	Het
Lrba	A	G	3: 86,295,179	N246D	probably damaging	Het
Lrrc45	T	A	11: 120,714,907		probably benign	Het
Mdh2	G	T	5: 135,789,679	V263L	probably benign	Het
Myom1	T	A	17: 71,034,693	V149E	probably damaging	Het
Nanos1	A	T	19: 60,757,041	D259V	probably damaging	Het
Nedd4l	T	A	18: 65,161,654		probably benign	Het
Npas3	A	G	12: 53,831,745	Y150C	probably damaging	Het
Olfr1066	T	C	2: 86,456,019	N84S	possibly damaging	Het
Olfr1129	T	A	2: 87,575,567	V161D	possibly damaging	Het
Olfr1392	A	T	11: 49,293,338	I6F	probably benign	Het
Olfr479	A	T	7: 108,055,963	H327L	probably benign	Het
Olfr672	G	A	7: 104,996,706	A66V	probably damaging	Het
Olfr93	C	T	17: 37,151,555	C139Y	probably damaging	Het
Pde4c	A	G	8: 70,750,076	N637S	probably benign	Het
Pds5b	T	A	5: 150,779,275	V824D	possibly damaging	Het
Pole2	A	T	12: 69,222,386		probably benign	Het
Ppig	C	T	2: 69,735,976		probably benign	Het
Prep	A	G	10: 45,092,676	Y90C	probably damaging	Het
Proca1	A	T	11: 78,194,905	R11S	probably damaging	Het
Prph	T	A	15: 99,056,991	W313R	probably benign	Het
Prune2	C	T	19: 17,123,080	P1983S	probably benign	Het
Ptbp2	G	A	3: 119,724,198		probably benign	Het
Rsph6a	C	T	7: 19,074,106	P398L	probably damaging	Het
Sdk2	T	C	11: 113,829,967	I1379V	probably benign	Het
Sf3b1	C	T	1: 55,019,271	G53E	probably damaging	Het
Slc9a3	T	C	13: 74,157,784		probably null	Het
Smarcal1	A	T	1: 72,626,473	H710L	probably benign	Het
Soat2	GAGAAG	GAG	15: 102,150,707		probably benign	Het
Sptan1	T	C	2: 29,991,033	V438A	probably damaging	Het
Sstr4	T	A	2: 148,396,261	V264D	probably damaging	Het
Susd2	A	G	10: 75,639,911	L418P	probably damaging	Het
Synj1	A	G	16: 90,938,640	V1475A	probably benign	Het
Szt2	G	A	4: 118,376,347		probably benign	Het
Tbc1d4	T	C	14: 101,458,063		probably null	Het
Tesk1	A	G	4: 43,446,000	E311G	probably damaging	Het
Tmed5	A	T	5: 108,126,016	V119E	probably damaging	Het
Tmem260	T	C	14: 48,486,867	S201P	possibly damaging	Het
Tnxb	A	G	17: 34,671,733	Y350C	probably damaging	Het
Tpte	T	C	8: 22,335,608		probably benign	Het
Trim37	A	T	11: 87,146,968	D161V	probably damaging	Het
Tspoap1	T	C	11: 87,776,346		probably benign	Het
Ttk	T	A	9: 83,847,260		probably benign	Het
Vmn1r172	A	G	7: 23,660,532	S281G	probably benign	Het
Vmn1r177	A	G	7: 23,865,597	S285P	probably damaging	Het
Vmn1r231	C	T	17: 20,890,399	V85I	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r118	T	C	17: 55,608,643	I436V	probably benign	Het
Vmn2r12	T	C	5: 109,092,899	K116R	probably benign	Het
Vmn2r28	T	A	7: 5,488,514	I245L	probably benign	Het
Wdr26	A	T	1: 181,180,651		probably benign	Het
Xrcc3	A	T	12: 111,809,957	H67Q	probably benign	Het
Zbbx	A	T	3: 75,078,495	S417T	possibly damaging	Het
Zc3h13	A	G	14: 75,323,482	D504G	unknown	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zyg11b	A	T	4: 108,255,308	F388I	probably damaging	Het

Other mutations in Trrap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Trrap	APN	5	144779974	splice site	probably benign
IGL00470:Trrap	APN	5	144818038	missense	probably damaging	1.00
IGL00490:Trrap	APN	5	144825225	missense	probably benign	0.40
IGL01072:Trrap	APN	5	144784255	splice site	probably benign
IGL01087:Trrap	APN	5	144846539	missense	probably damaging	0.99
IGL01300:Trrap	APN	5	144804818	missense	probably damaging	1.00
IGL01350:Trrap	APN	5	144830969	missense	possibly damaging	0.92
IGL01410:Trrap	APN	5	144831021	missense	probably benign	0.00
IGL01571:Trrap	APN	5	144833287	splice site	probably benign
IGL01748:Trrap	APN	5	144833340	missense	probably damaging	1.00
IGL01839:Trrap	APN	5	144821875	missense	probably damaging	1.00
IGL01976:Trrap	APN	5	144856989	missense	probably benign	0.00
IGL02075:Trrap	APN	5	144828494	missense	probably benign	0.00
IGL02127:Trrap	APN	5	144816433	missense	probably benign	0.22
IGL02131:Trrap	APN	5	144840436	missense	probably damaging	1.00
IGL02287:Trrap	APN	5	144832538	missense	probably damaging	1.00
IGL02301:Trrap	APN	5	144777917	missense	probably benign	0.05
IGL02336:Trrap	APN	5	144798390	missense	probably benign	0.39
IGL02526:Trrap	APN	5	144824550	missense	probably benign	0.00
IGL02873:Trrap	APN	5	144841079	splice site	probably benign
IGL02953:Trrap	APN	5	144815964	missense	probably damaging	0.99
IGL03404:Trrap	APN	5	144833186	missense	probably benign	0.00
Buffer	UTSW	5	144834204	missense	probably benign	0.06
Card-tower	UTSW	5	144804766	missense	probably damaging	1.00
Cookie	UTSW	5	144794049	missense	probably damaging	1.00
Glass_house	UTSW	5	144845477	missense	possibly damaging	0.67
Immovable	UTSW	5	144790855	missense	possibly damaging	0.66
R5049_trrap_520	UTSW	5	144826717	missense	probably damaging	1.00
R7167_Trrap_977	UTSW	5	144839614	missense	probably benign	0.39
vitreous	UTSW	5	144805727	missense	probably damaging	1.00
PIT4243001:Trrap	UTSW	5	144796971	missense	probably benign	0.00
PIT4466001:Trrap	UTSW	5	144828600	missense	probably benign	0.02
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0112:Trrap	UTSW	5	144822761	nonsense	probably null
R0126:Trrap	UTSW	5	144805750	nonsense	probably null
R0257:Trrap	UTSW	5	144804235	missense	probably benign	0.31
R0325:Trrap	UTSW	5	144816395	missense	probably benign	0.05
R0376:Trrap	UTSW	5	144816339	missense	probably benign	0.03
R0448:Trrap	UTSW	5	144839567	missense	possibly damaging	0.66
R0454:Trrap	UTSW	5	144846477	missense	probably damaging	1.00
R0711:Trrap	UTSW	5	144853499	missense	probably damaging	1.00
R0827:Trrap	UTSW	5	144814830	missense	probably benign	0.00
R1005:Trrap	UTSW	5	144805727	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1179:Trrap	UTSW	5	144777939	missense	possibly damaging	0.94
R1218:Trrap	UTSW	5	144816409	missense	probably damaging	1.00
R1264:Trrap	UTSW	5	144789599	splice site	probably benign
R1374:Trrap	UTSW	5	144846618	missense	probably damaging	1.00
R1401:Trrap	UTSW	5	144857422	missense	possibly damaging	0.93
R1480:Trrap	UTSW	5	144818313	missense	probably benign
R1538:Trrap	UTSW	5	144837202	missense	possibly damaging	0.65
R1751:Trrap	UTSW	5	144814575	critical splice donor site	probably null
R1779:Trrap	UTSW	5	144828590	missense	probably benign	0.01
R1782:Trrap	UTSW	5	144822703	missense	possibly damaging	0.93
R1792:Trrap	UTSW	5	144853586	missense	possibly damaging	0.87
R1859:Trrap	UTSW	5	144830951	missense	probably benign	0.04
R1861:Trrap	UTSW	5	144815917	splice site	probably null
R1902:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R1903:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R2021:Trrap	UTSW	5	144853488	missense	possibly damaging	0.94
R2026:Trrap	UTSW	5	144803044	missense	possibly damaging	0.86
R2036:Trrap	UTSW	5	144828562	missense	probably benign	0.08
R2099:Trrap	UTSW	5	144782239	missense	possibly damaging	0.46
R2108:Trrap	UTSW	5	144825874	missense	probably benign	0.01
R2113:Trrap	UTSW	5	144844211	missense	probably damaging	1.00
R2174:Trrap	UTSW	5	144821855	missense	probably benign	0.40
R2442:Trrap	UTSW	5	144817966	missense	probably damaging	1.00
R2568:Trrap	UTSW	5	144843369	critical splice donor site	probably null
R3442:Trrap	UTSW	5	144792252	missense	probably benign	0.03
R3853:Trrap	UTSW	5	144792165	missense	probably damaging	1.00
R4401:Trrap	UTSW	5	144843318	missense	possibly damaging	0.60
R4493:Trrap	UTSW	5	144831048	missense	probably benign	0.21
R4524:Trrap	UTSW	5	144825321	missense	probably benign	0.38
R4569:Trrap	UTSW	5	144792118	missense	probably benign	0.13
R4672:Trrap	UTSW	5	144785480	missense	probably damaging	0.97
R4732:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4733:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4791:Trrap	UTSW	5	144803277	missense	probably damaging	1.00
R4795:Trrap	UTSW	5	144832488	missense	probably benign	0.06
R4827:Trrap	UTSW	5	144800948	missense	probably benign	0.02
R4839:Trrap	UTSW	5	144845592	missense	probably damaging	1.00
R4915:Trrap	UTSW	5	144805735	missense	probably damaging	0.99
R4951:Trrap	UTSW	5	144805720	missense	possibly damaging	0.65
R4959:Trrap	UTSW	5	144856960	missense	probably damaging	1.00
R5049:Trrap	UTSW	5	144826717	missense	probably damaging	1.00
R5074:Trrap	UTSW	5	144851179	missense	probably damaging	1.00
R5236:Trrap	UTSW	5	144817786	missense	probably benign	0.07
R5281:Trrap	UTSW	5	144813503	missense	probably benign	0.13
R5322:Trrap	UTSW	5	144844224	missense	probably damaging	1.00
R5457:Trrap	UTSW	5	144849977	missense	probably damaging	1.00
R5590:Trrap	UTSW	5	144782265	missense	probably benign	0.05
R5799:Trrap	UTSW	5	144830945	missense	probably benign
R5885:Trrap	UTSW	5	144794793	missense	probably damaging	1.00
R5905:Trrap	UTSW	5	144849920	missense	possibly damaging	0.95
R5908:Trrap	UTSW	5	144786708	missense	probably damaging	0.96
R5956:Trrap	UTSW	5	144807391	splice site	silent
R5992:Trrap	UTSW	5	144810184	missense	probably benign	0.00
R6017:Trrap	UTSW	5	144844241	missense	probably damaging	1.00
R6029:Trrap	UTSW	5	144817679	missense	possibly damaging	0.94
R6029:Trrap	UTSW	5	144825914	missense	possibly damaging	0.75
R6117:Trrap	UTSW	5	144802961	missense	possibly damaging	0.78
R6166:Trrap	UTSW	5	144781981	missense	possibly damaging	0.66
R6234:Trrap	UTSW	5	144839713	splice site	probably null
R6288:Trrap	UTSW	5	144811992	missense	probably damaging	1.00
R6290:Trrap	UTSW	5	144805018	missense	probably damaging	1.00
R6316:Trrap	UTSW	5	144813526	missense	probably benign	0.02
R6398:Trrap	UTSW	5	144790870	missense	possibly damaging	0.83
R6413:Trrap	UTSW	5	144784046	missense	possibly damaging	0.83
R6499:Trrap	UTSW	5	144857002	missense	probably damaging	1.00
R6529:Trrap	UTSW	5	144834204	missense	probably benign	0.06
R6574:Trrap	UTSW	5	144815550	critical splice donor site	probably null
R6631:Trrap	UTSW	5	144771650	missense	possibly damaging	0.94
R6727:Trrap	UTSW	5	144856950	missense	probably damaging	1.00
R6776:Trrap	UTSW	5	144851256	nonsense	probably null
R6914:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6942:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6945:Trrap	UTSW	5	144790855	missense	possibly damaging	0.66
R7023:Trrap	UTSW	5	144792154	missense	possibly damaging	0.64
R7107:Trrap	UTSW	5	144797135	missense	probably benign	0.05
R7139:Trrap	UTSW	5	144803178	missense	possibly damaging	0.65
R7148:Trrap	UTSW	5	144821803	missense	possibly damaging	0.77
R7167:Trrap	UTSW	5	144839614	missense	probably benign	0.39
R7171:Trrap	UTSW	5	144794049	missense	probably damaging	1.00
R7205:Trrap	UTSW	5	144842707	missense	possibly damaging	0.94
R7215:Trrap	UTSW	5	144797135	missense	probably benign	0.05
R7255:Trrap	UTSW	5	144858954	missense	probably damaging	1.00
R7261:Trrap	UTSW	5	144845477	missense	possibly damaging	0.67
R7264:Trrap	UTSW	5	144814523	missense	probably benign	0.05
R7372:Trrap	UTSW	5	144789398	missense	probably benign
R7447:Trrap	UTSW	5	144839474	missense	probably damaging	0.97
R7449:Trrap	UTSW	5	144851209	missense	probably damaging	1.00
R7655:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7656:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7662:Trrap	UTSW	5	144832511	missense	probably benign	0.00
R7716:Trrap	UTSW	5	144777146	missense	possibly damaging	0.73
R8143:Trrap	UTSW	5	144835897	splice site	probably null
R8183:Trrap	UTSW	5	144828533	missense	probably benign	0.01
R8265:Trrap	UTSW	5	144785534	missense	possibly damaging	0.53
R8273:Trrap	UTSW	5	144791165	missense	probably damaging	1.00
R8556:Trrap	UTSW	5	144825937	missense	probably benign	0.44
R8674:Trrap	UTSW	5	144791032	missense	probably benign	0.02
R8777:Trrap	UTSW	5	144837139	missense	probably benign	0.10
R8777-TAIL:Trrap	UTSW	5	144837139	missense	probably benign	0.10
R8817:Trrap	UTSW	5	144845538	missense	probably damaging	1.00
R8841:Trrap	UTSW	5	144844211	missense	probably damaging	1.00
R8871:Trrap	UTSW	5	144821839	missense	probably benign	0.30
R8937:Trrap	UTSW	5	144820253	missense	probably damaging	1.00
R8966:Trrap	UTSW	5	144803352	missense	probably damaging	0.96
R9010:Trrap	UTSW	5	144846416	missense	probably damaging	1.00
R9095:Trrap	UTSW	5	144797151	missense	probably damaging	1.00
R9127:Trrap	UTSW	5	144831020	missense	probably benign	0.16
R9132:Trrap	UTSW	5	144789552	missense	probably benign	0.03
R9224:Trrap	UTSW	5	144771239	missense	possibly damaging	0.70
R9338:Trrap	UTSW	5	144791115	missense	probably benign
R9380:Trrap	UTSW	5	144833171	missense	probably benign
R9404:Trrap	UTSW	5	144815415	missense	possibly damaging	0.85
X0060:Trrap	UTSW	5	144843361	missense	probably damaging	0.96
Z1088:Trrap	UTSW	5	144834197	missense	probably benign	0.00
Z1177:Trrap	UTSW	5	144810344	missense
Z1177:Trrap	UTSW	5	144819708	missense	probably damaging	1.00
Z1177:Trrap	UTSW	5	144856951	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGTGAGTCTGATCTGATCCAAGC -3'
(R):5'- AGTTGGTGGCAGCCATGTTCTC -3'

Sequencing Primer
(F):5'- GATCTGATCCAAGCAACTTTCC -3'
(R):5'- CAACTGGCTCACCAGAGAGTG -3'

Posted On

2013-04-24