Incidental Mutation 'R4243:Gm5174'
ID 320310
Institutional Source Beutler Lab
Gene Symbol Gm5174
Ensembl Gene ENSMUSG00000090308
Gene Name predicted gene 5174
Synonyms
MMRRC Submission 041643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4243 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86655939-86657381 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 86656280 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171131
SMART Domains Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

DomainStartEndE-ValueType
S_TKc 14 262 5.59e-86 SMART
UBA 276 313 1.28e-3 SMART
low complexity region 447 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219608
Meta Mutation Damage Score 0.6034 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik C A 5: 114,813,794 R40L possibly damaging Het
4930449A18Rik T A 3: 59,825,782 noncoding transcript Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
4933409G03Rik C T 2: 68,593,543 probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Birc2 T C 9: 7,834,385 T32A probably benign Het
Cdh13 T A 8: 119,242,257 V451E probably damaging Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Cdt1 A G 8: 122,571,418 M383V probably benign Het
Chrna9 T C 5: 65,935,036 probably null Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cspg4 T C 9: 56,887,857 S959P probably benign Het
Ctbp2 A G 7: 132,998,854 I647T probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Ddx1 A T 12: 13,240,909 C68* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dynlt1b T C 17: 6,430,240 probably null Het
Faxc G A 4: 21,982,491 R310Q probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Frmd5 C A 2: 121,562,882 probably null Het
Hspa12b C T 2: 131,141,858 H293Y possibly damaging Het
Jakmip2 A G 18: 43,577,436 V234A probably benign Het
Jkamp G A 12: 72,094,025 V108I probably benign Het
Mettl23 T C 11: 116,848,300 V72A possibly damaging Het
Morc2b T A 17: 33,136,401 Y799F probably benign Het
Mtmr11 T A 3: 96,168,077 C358S probably damaging Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Mysm1 A G 4: 94,969,011 V120A probably benign Het
Nhlrc1 C T 13: 47,014,026 V252I probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Olfr530 G A 7: 140,372,944 A222V probably benign Het
Olfr855 C A 9: 19,584,558 T7K probably damaging Het
Pard3 G A 8: 127,371,647 A390T probably benign Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Phactr3 G A 2: 178,283,189 probably null Het
Pkn2 T C 3: 142,820,578 N413D possibly damaging Het
Ppp1r12b T G 1: 134,782,108 probably benign Het
Ptprf A G 4: 118,226,452 probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rasa1 A G 13: 85,244,195 Y407H probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Slc27a1 A G 8: 71,584,973 T535A probably benign Het
Stra6 G A 9: 58,143,026 A237T probably benign Het
Tor1aip2 A G 1: 156,065,436 E496G probably damaging Het
Usp47 A G 7: 112,108,629 D1294G probably damaging Het
Utp20 A G 10: 88,807,325 probably null Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zbtb40 C T 4: 137,018,549 A58T probably benign Het
Zfhx3 A G 8: 108,792,320 T25A probably damaging Het
Other mutations in Gm5174
AlleleSourceChrCoordTypePredicted EffectPPH Score
Laco UTSW 10 86656108 unclassified noncoding transcript
R1083:Gm5174 UTSW 10 86656108 unclassified noncoding transcript
R1199:Gm5174 UTSW 10 86657325 unclassified noncoding transcript
R1296:Gm5174 UTSW 10 86657002 unclassified noncoding transcript
R1715:Gm5174 UTSW 10 86656912 unclassified noncoding transcript
R1957:Gm5174 UTSW 10 86656753 unclassified noncoding transcript
R2221:Gm5174 UTSW 10 86656508 unclassified noncoding transcript
R2223:Gm5174 UTSW 10 86656508 unclassified noncoding transcript
R3104:Gm5174 UTSW 10 86656655 unclassified noncoding transcript
R4165:Gm5174 UTSW 10 86656933 unclassified noncoding transcript
R4166:Gm5174 UTSW 10 86656933 unclassified noncoding transcript
R4244:Gm5174 UTSW 10 86656280 unclassified noncoding transcript
R5024:Gm5174 UTSW 10 86656587 unclassified noncoding transcript
R5292:Gm5174 UTSW 10 86656698 unclassified noncoding transcript
R5586:Gm5174 UTSW 10 86656545 unclassified noncoding transcript
R5864:Gm5174 UTSW 10 86657181 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGCACCTGAAAACAGAGGCC -3'
(R):5'- TATCTCTGGCGCCCAAAAC -3'

Sequencing Primer
(F):5'- CCCTGGTTGCCGTAAAAATG -3'
(R):5'- TGGCGCCCAAAACCTCTTG -3'
Posted On 2015-06-12