Incidental Mutation 'R4243:Ddx1'
ID320314
Institutional Source Beutler Lab
Gene Symbol Ddx1
Ensembl Gene ENSMUSG00000037149
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Synonyms
MMRRC Submission 041643-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4243 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location13216973-13249213 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 13240909 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 68 (C68*)
Ref Sequence ENSEMBL: ENSMUSP00000152513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071103] [ENSMUST00000221623]
Predicted Effect probably null
Transcript: ENSMUST00000071103
AA Change: C111*
SMART Domains Protein: ENSMUSP00000065987
Gene: ENSMUSG00000037149
AA Change: C111*

DomainStartEndE-ValueType
DEXDc 21 444 1.95e-47 SMART
SPRY 130 246 1.91e-34 SMART
HELICc 520 610 8.28e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000221623
AA Change: C68*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik C A 5: 114,813,794 R40L possibly damaging Het
4930449A18Rik T A 3: 59,825,782 noncoding transcript Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
4933409G03Rik C T 2: 68,593,543 probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Birc2 T C 9: 7,834,385 T32A probably benign Het
Cdh13 T A 8: 119,242,257 V451E probably damaging Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Cdt1 A G 8: 122,571,418 M383V probably benign Het
Chrna9 T C 5: 65,935,036 probably null Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cspg4 T C 9: 56,887,857 S959P probably benign Het
Ctbp2 A G 7: 132,998,854 I647T probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dynlt1b T C 17: 6,430,240 probably null Het
Faxc G A 4: 21,982,491 R310Q probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Frmd5 C A 2: 121,562,882 probably null Het
Gm5174 C A 10: 86,656,280 noncoding transcript Het
Hspa12b C T 2: 131,141,858 H293Y possibly damaging Het
Jakmip2 A G 18: 43,577,436 V234A probably benign Het
Jkamp G A 12: 72,094,025 V108I probably benign Het
Mettl23 T C 11: 116,848,300 V72A possibly damaging Het
Morc2b T A 17: 33,136,401 Y799F probably benign Het
Mtmr11 T A 3: 96,168,077 C358S probably damaging Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Mysm1 A G 4: 94,969,011 V120A probably benign Het
Nhlrc1 C T 13: 47,014,026 V252I probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Olfr530 G A 7: 140,372,944 A222V probably benign Het
Olfr855 C A 9: 19,584,558 T7K probably damaging Het
Pard3 G A 8: 127,371,647 A390T probably benign Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Phactr3 G A 2: 178,283,189 probably null Het
Pkn2 T C 3: 142,820,578 N413D possibly damaging Het
Ppp1r12b T G 1: 134,782,108 probably benign Het
Ptprf A G 4: 118,226,452 probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rasa1 A G 13: 85,244,195 Y407H probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Slc27a1 A G 8: 71,584,973 T535A probably benign Het
Stra6 G A 9: 58,143,026 A237T probably benign Het
Tor1aip2 A G 1: 156,065,436 E496G probably damaging Het
Usp47 A G 7: 112,108,629 D1294G probably damaging Het
Utp20 A G 10: 88,807,325 probably null Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zbtb40 C T 4: 137,018,549 A58T probably benign Het
Zfhx3 A G 8: 108,792,320 T25A probably damaging Het
Other mutations in Ddx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ddx1 APN 12 13227459 splice site probably benign
IGL00725:Ddx1 APN 12 13245690 missense probably damaging 1.00
IGL00958:Ddx1 APN 12 13240848 splice site probably null
IGL01786:Ddx1 APN 12 13229136 missense probably benign
IGL02832:Ddx1 APN 12 13227317 nonsense probably null
IGL02983:Ddx1 APN 12 13223862 missense probably damaging 1.00
R0201:Ddx1 UTSW 12 13223808 missense probably damaging 1.00
R0931:Ddx1 UTSW 12 13237817 splice site probably benign
R1434:Ddx1 UTSW 12 13237231 missense probably benign 0.01
R1558:Ddx1 UTSW 12 13239541 missense probably damaging 1.00
R1673:Ddx1 UTSW 12 13244966 critical splice donor site probably null
R1854:Ddx1 UTSW 12 13229331 missense probably benign 0.19
R2910:Ddx1 UTSW 12 13231440 splice site probably null
R2911:Ddx1 UTSW 12 13231440 splice site probably null
R4181:Ddx1 UTSW 12 13231503 nonsense probably null
R4182:Ddx1 UTSW 12 13231503 nonsense probably null
R4183:Ddx1 UTSW 12 13231503 nonsense probably null
R4231:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4234:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4235:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4717:Ddx1 UTSW 12 13240887 missense probably damaging 1.00
R4821:Ddx1 UTSW 12 13239147 missense probably damaging 1.00
R5032:Ddx1 UTSW 12 13223992 missense probably damaging 1.00
R5082:Ddx1 UTSW 12 13220435 nonsense probably null
R5528:Ddx1 UTSW 12 13229294 missense probably damaging 1.00
R5997:Ddx1 UTSW 12 13237799 missense probably damaging 1.00
R6398:Ddx1 UTSW 12 13245720 missense probably damaging 1.00
R6891:Ddx1 UTSW 12 13236095 missense probably benign 0.25
R7085:Ddx1 UTSW 12 13229355 missense probably damaging 1.00
R7125:Ddx1 UTSW 12 13243863 missense probably benign 0.18
R7307:Ddx1 UTSW 12 13223959 missense probably damaging 1.00
R7388:Ddx1 UTSW 12 13225455 missense probably null 1.00
R7393:Ddx1 UTSW 12 13230353 missense probably benign 0.03
R7460:Ddx1 UTSW 12 13231439 splice site probably null
X0011:Ddx1 UTSW 12 13229415 missense probably damaging 1.00
X0028:Ddx1 UTSW 12 13243866 missense probably benign 0.00
Z1177:Ddx1 UTSW 12 13229259 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAAGACCTGTGGATCTTTCTG -3'
(R):5'- TGACAGTGTAGACCCTGGTCAC -3'

Sequencing Primer
(F):5'- CCTGTGGATCTTTCTGTGTCATTAAG -3'
(R):5'- TGGTCACCAGCATAGCCAAAGAG -3'
Posted On2015-06-12