Incidental Mutation 'R4243:Jakmip2'
ID 320322
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission 041643-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock # R4243 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43577436 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 234 (V234A)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably benign
Transcript: ENSMUST00000082254
AA Change: V234A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: V234A

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik C A 5: 114,813,794 R40L possibly damaging Het
4930449A18Rik T A 3: 59,825,782 noncoding transcript Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
4933409G03Rik C T 2: 68,593,543 probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Birc2 T C 9: 7,834,385 T32A probably benign Het
Cdh13 T A 8: 119,242,257 V451E probably damaging Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Cdt1 A G 8: 122,571,418 M383V probably benign Het
Chrna9 T C 5: 65,935,036 probably null Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cspg4 T C 9: 56,887,857 S959P probably benign Het
Ctbp2 A G 7: 132,998,854 I647T probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Ddx1 A T 12: 13,240,909 C68* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dynlt1b T C 17: 6,430,240 probably null Het
Faxc G A 4: 21,982,491 R310Q probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Frmd5 C A 2: 121,562,882 probably null Het
Gm5174 C A 10: 86,656,280 noncoding transcript Het
Hspa12b C T 2: 131,141,858 H293Y possibly damaging Het
Jkamp G A 12: 72,094,025 V108I probably benign Het
Mettl23 T C 11: 116,848,300 V72A possibly damaging Het
Morc2b T A 17: 33,136,401 Y799F probably benign Het
Mtmr11 T A 3: 96,168,077 C358S probably damaging Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Mysm1 A G 4: 94,969,011 V120A probably benign Het
Nhlrc1 C T 13: 47,014,026 V252I probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Olfr530 G A 7: 140,372,944 A222V probably benign Het
Olfr855 C A 9: 19,584,558 T7K probably damaging Het
Pard3 G A 8: 127,371,647 A390T probably benign Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Phactr3 G A 2: 178,283,189 probably null Het
Pkn2 T C 3: 142,820,578 N413D possibly damaging Het
Ppp1r12b T G 1: 134,782,108 probably benign Het
Ptprf A G 4: 118,226,452 probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rasa1 A G 13: 85,244,195 Y407H probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Slc27a1 A G 8: 71,584,973 T535A probably benign Het
Stra6 G A 9: 58,143,026 A237T probably benign Het
Tor1aip2 A G 1: 156,065,436 E496G probably damaging Het
Usp47 A G 7: 112,108,629 D1294G probably damaging Het
Utp20 A G 10: 88,807,325 probably null Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zbtb40 C T 4: 137,018,549 A58T probably benign Het
Zfhx3 A G 8: 108,792,320 T25A probably damaging Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43571181 missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43562592 missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43568108 missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43557367 missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43577325 missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43582287 missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43552177 missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43571896 missense probably benign
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43571862 missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCCACTCTGGAGTTGTTAACC -3'
(R):5'- GTGAGTTCAGTACACTGCATGTC -3'

Sequencing Primer
(F):5'- TGTTAACCTCAAGTCGCAGG -3'
(R):5'- AGCCAAGGACAGGATCAT -3'
Posted On 2015-06-12