Incidental Mutation 'R0396:D630045J12Rik'
ID 32033
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene Name RIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 038602-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0396 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 38100109-38230944 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38173671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 166 (S166G)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
AlphaFold Q68FD9
Predicted Effect possibly damaging
Transcript: ENSMUST00000117556
AA Change: S25G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: S25G

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect possibly damaging
Transcript: ENSMUST00000169256
AA Change: S166G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: S166G

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik G A 8: 106,436,412 (GRCm39) V194I probably benign Het
Acsm1 A T 7: 119,235,678 (GRCm39) I133F probably damaging Het
Adamts9 T A 6: 92,774,986 (GRCm39) T1676S probably benign Het
Adcy4 T C 14: 56,009,745 (GRCm39) D769G probably benign Het
Aif1 T C 17: 35,390,085 (GRCm39) *148W probably null Het
Akna C T 4: 63,310,363 (GRCm39) probably benign Het
Arhgap32 G A 9: 32,156,551 (GRCm39) probably null Het
Atpaf1 G A 4: 115,642,449 (GRCm39) E92K possibly damaging Het
Bltp2 T C 11: 78,159,203 (GRCm39) V467A possibly damaging Het
C1s1 T C 6: 124,510,313 (GRCm39) E378G probably benign Het
Caprin1 T A 2: 103,599,914 (GRCm39) Q108L probably damaging Het
Car13 A T 3: 14,721,299 (GRCm39) H154L probably benign Het
Cdon C A 9: 35,381,426 (GRCm39) N605K probably damaging Het
Ceacam10 G A 7: 24,480,439 (GRCm39) G70E probably damaging Het
Cfap221 G A 1: 119,881,930 (GRCm39) T286M probably benign Het
Cfap61 T C 2: 145,791,864 (GRCm39) F107S possibly damaging Het
Coil C A 11: 88,872,449 (GRCm39) T270N probably benign Het
Crocc2 T G 1: 93,151,936 (GRCm39) probably benign Het
Crot T C 5: 9,019,959 (GRCm39) E461G probably damaging Het
D130052B06Rik G T 11: 33,573,391 (GRCm39) R41L unknown Het
Dennd4a T G 9: 64,769,673 (GRCm39) V460G probably damaging Het
Depdc7 A T 2: 104,557,668 (GRCm39) probably benign Het
Dgkb G A 12: 38,240,134 (GRCm39) probably null Het
Dhx57 T G 17: 80,582,226 (GRCm39) S407R probably benign Het
Dnase2a G T 8: 85,636,392 (GRCm39) probably benign Het
Dqx1 T G 6: 83,035,986 (GRCm39) M106R probably benign Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Ephx2 T G 14: 66,345,512 (GRCm39) I151L probably benign Het
Gdf3 C T 6: 122,584,094 (GRCm39) G91D probably damaging Het
Gpc5 T A 14: 115,665,620 (GRCm39) N481K possibly damaging Het
Gsdme T A 6: 50,198,087 (GRCm39) H291L probably benign Het
H2-T13 A G 17: 36,394,614 (GRCm39) I103T possibly damaging Het
Hif3a G A 7: 16,785,946 (GRCm39) probably benign Het
Hmox2 A T 16: 4,583,627 (GRCm39) I232L probably benign Het
Itgb2 A G 10: 77,397,023 (GRCm39) Y686C probably damaging Het
Jmjd1c A G 10: 67,055,302 (GRCm39) T528A possibly damaging Het
Kdr T C 5: 76,121,388 (GRCm39) I541V possibly damaging Het
Khdrbs2 C A 1: 32,559,054 (GRCm39) V343L probably damaging Het
Kif16b C T 2: 142,695,579 (GRCm39) R175H probably damaging Het
Klri2 T G 6: 129,717,251 (GRCm39) E44A possibly damaging Het
Kmt2b G T 7: 30,276,180 (GRCm39) T1773K probably damaging Het
Lair1 A G 7: 4,013,785 (GRCm39) L154P probably damaging Het
Larp1b G A 3: 40,924,996 (GRCm39) V158M probably damaging Het
Lgi3 T A 14: 70,772,280 (GRCm39) I275N probably damaging Het
Lrba A G 3: 86,202,486 (GRCm39) N246D probably damaging Het
Lrrc45 T A 11: 120,605,733 (GRCm39) probably benign Het
Mdh2 G T 5: 135,818,533 (GRCm39) V263L probably benign Het
Myom1 T A 17: 71,341,688 (GRCm39) V149E probably damaging Het
Nanos1 A T 19: 60,745,479 (GRCm39) D259V probably damaging Het
Nedd4l T A 18: 65,294,725 (GRCm39) probably benign Het
Npas3 A G 12: 53,878,528 (GRCm39) Y150C probably damaging Het
Or10ab4 A T 7: 107,655,170 (GRCm39) H327L probably benign Het
Or10ag59 T A 2: 87,405,911 (GRCm39) V161D possibly damaging Het
Or2h1b C T 17: 37,462,446 (GRCm39) C139Y probably damaging Het
Or2y1f A T 11: 49,184,165 (GRCm39) I6F probably benign Het
Or52e15 G A 7: 104,645,913 (GRCm39) A66V probably damaging Het
Or8k28 T C 2: 86,286,363 (GRCm39) N84S possibly damaging Het
Pde4c A G 8: 71,202,725 (GRCm39) N637S probably benign Het
Pds5b T A 5: 150,702,740 (GRCm39) V824D possibly damaging Het
Pole2 A T 12: 69,269,160 (GRCm39) probably benign Het
Ppig C T 2: 69,566,320 (GRCm39) probably benign Het
Prep A G 10: 44,968,772 (GRCm39) Y90C probably damaging Het
Proca1 A T 11: 78,085,731 (GRCm39) R11S probably damaging Het
Prph T A 15: 98,954,872 (GRCm39) W313R probably benign Het
Prune2 C T 19: 17,100,444 (GRCm39) P1983S probably benign Het
Ptbp2 G A 3: 119,517,847 (GRCm39) probably benign Het
Rsph6a C T 7: 18,808,031 (GRCm39) P398L probably damaging Het
Sdk2 T C 11: 113,720,793 (GRCm39) I1379V probably benign Het
Sf3b1 C T 1: 55,058,430 (GRCm39) G53E probably damaging Het
Slc9a3 T C 13: 74,305,903 (GRCm39) probably null Het
Smarcal1 A T 1: 72,665,632 (GRCm39) H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,059,142 (GRCm39) probably benign Het
Sptan1 T C 2: 29,881,045 (GRCm39) V438A probably damaging Het
Sstr4 T A 2: 148,238,181 (GRCm39) V264D probably damaging Het
Susd2 A G 10: 75,475,745 (GRCm39) L418P probably damaging Het
Synj1 A G 16: 90,735,528 (GRCm39) V1475A probably benign Het
Szt2 G A 4: 118,233,544 (GRCm39) probably benign Het
Tbc1d4 T C 14: 101,695,499 (GRCm39) probably null Het
Tesk1 A G 4: 43,446,000 (GRCm39) E311G probably damaging Het
Tmed5 A T 5: 108,273,882 (GRCm39) V119E probably damaging Het
Tmem260 T C 14: 48,724,324 (GRCm39) S201P possibly damaging Het
Tnxb A G 17: 34,890,707 (GRCm39) Y350C probably damaging Het
Tpte T C 8: 22,825,624 (GRCm39) probably benign Het
Trim37 A T 11: 87,037,794 (GRCm39) D161V probably damaging Het
Trrap C A 5: 144,751,366 (GRCm39) Q1640K probably damaging Het
Tspoap1 T C 11: 87,667,172 (GRCm39) probably benign Het
Ttk T A 9: 83,729,313 (GRCm39) probably benign Het
Vmn1r172 A G 7: 23,359,957 (GRCm39) S281G probably benign Het
Vmn1r177 A G 7: 23,565,022 (GRCm39) S285P probably damaging Het
Vmn1r231 C T 17: 21,110,661 (GRCm39) V85I probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r118 T C 17: 55,915,643 (GRCm39) I436V probably benign Het
Vmn2r12 T C 5: 109,240,765 (GRCm39) K116R probably benign Het
Vmn2r28 T A 7: 5,491,513 (GRCm39) I245L probably benign Het
Wdr26 A T 1: 181,008,216 (GRCm39) probably benign Het
Xrcc3 A T 12: 111,776,391 (GRCm39) H67Q probably benign Het
Zbbx A T 3: 74,985,802 (GRCm39) S417T possibly damaging Het
Zc3h13 A G 14: 75,560,922 (GRCm39) D504G unknown Het
Zfp1005 G A 2: 150,109,973 (GRCm39) G221D probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zyg11b A T 4: 108,112,505 (GRCm39) F388I probably damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38,171,865 (GRCm39) missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38,113,898 (GRCm39) missense probably benign
IGL01745:D630045J12Rik APN 6 38,168,655 (GRCm39) missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38,161,007 (GRCm39) missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38,173,329 (GRCm39) missense probably benign
IGL02496:D630045J12Rik APN 6 38,126,640 (GRCm39) missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38,172,420 (GRCm39) missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38,126,648 (GRCm39) missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38,145,156 (GRCm39) missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38,124,194 (GRCm39) missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38,155,774 (GRCm39) missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38,172,036 (GRCm39) missense probably benign
R0021:D630045J12Rik UTSW 6 38,160,902 (GRCm39) nonsense probably null
R0021:D630045J12Rik UTSW 6 38,160,902 (GRCm39) nonsense probably null
R0128:D630045J12Rik UTSW 6 38,126,706 (GRCm39) splice site probably benign
R0130:D630045J12Rik UTSW 6 38,126,706 (GRCm39) splice site probably benign
R0206:D630045J12Rik UTSW 6 38,116,385 (GRCm39) missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38,116,385 (GRCm39) missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38,158,327 (GRCm39) missense probably damaging 0.97
R0538:D630045J12Rik UTSW 6 38,168,628 (GRCm39) missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38,173,713 (GRCm39) missense probably benign
R0842:D630045J12Rik UTSW 6 38,125,400 (GRCm39) missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38,171,705 (GRCm39) missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38,125,443 (GRCm39) missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38,125,443 (GRCm39) missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38,172,695 (GRCm39) missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38,167,590 (GRCm39) missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38,158,366 (GRCm39) missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38,116,362 (GRCm39) missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38,145,078 (GRCm39) missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38,145,078 (GRCm39) missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38,151,082 (GRCm39) critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38,135,026 (GRCm39) missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38,145,106 (GRCm39) missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38,119,844 (GRCm39) missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38,119,633 (GRCm39) missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38,171,696 (GRCm39) missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38,173,592 (GRCm39) missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38,172,971 (GRCm39) missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38,173,776 (GRCm39) missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38,125,275 (GRCm39) missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38,171,420 (GRCm39) missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38,125,478 (GRCm39) missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38,125,302 (GRCm39) missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38,125,302 (GRCm39) missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38,171,555 (GRCm39) missense probably benign
R5344:D630045J12Rik UTSW 6 38,135,163 (GRCm39) missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38,173,782 (GRCm39) missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38,173,782 (GRCm39) missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38,168,699 (GRCm39) missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38,173,302 (GRCm39) missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38,119,592 (GRCm39) missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38,171,904 (GRCm39) missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38,167,552 (GRCm39) missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38,107,799 (GRCm39) missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38,119,633 (GRCm39) missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38,124,132 (GRCm39) nonsense probably null
R6930:D630045J12Rik UTSW 6 38,135,151 (GRCm39) missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38,171,570 (GRCm39) missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38,171,964 (GRCm39) missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38,145,198 (GRCm39) missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38,113,885 (GRCm39) missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38,119,546 (GRCm39) missense possibly damaging 0.80
R7376:D630045J12Rik UTSW 6 38,151,238 (GRCm39) missense probably damaging 0.99
R7491:D630045J12Rik UTSW 6 38,119,601 (GRCm39) missense possibly damaging 0.89
R7552:D630045J12Rik UTSW 6 38,125,383 (GRCm39) missense probably damaging 0.99
R7560:D630045J12Rik UTSW 6 38,173,562 (GRCm39) missense possibly damaging 0.72
R7593:D630045J12Rik UTSW 6 38,172,429 (GRCm39) missense possibly damaging 0.93
R7624:D630045J12Rik UTSW 6 38,126,498 (GRCm39) missense probably damaging 1.00
R7654:D630045J12Rik UTSW 6 38,154,636 (GRCm39) missense probably damaging 1.00
R8159:D630045J12Rik UTSW 6 38,105,410 (GRCm39) missense probably damaging 0.99
R8167:D630045J12Rik UTSW 6 38,167,484 (GRCm39) critical splice donor site probably null
R8189:D630045J12Rik UTSW 6 38,135,106 (GRCm39) missense probably damaging 1.00
R8260:D630045J12Rik UTSW 6 38,119,846 (GRCm39) critical splice acceptor site probably null
R8270:D630045J12Rik UTSW 6 38,167,658 (GRCm39) nonsense probably null
R8331:D630045J12Rik UTSW 6 38,125,409 (GRCm39) missense probably damaging 1.00
R8363:D630045J12Rik UTSW 6 38,125,376 (GRCm39) missense probably damaging 1.00
R8365:D630045J12Rik UTSW 6 38,172,570 (GRCm39) missense probably benign
R8492:D630045J12Rik UTSW 6 38,167,525 (GRCm39) missense probably damaging 1.00
R8560:D630045J12Rik UTSW 6 38,126,649 (GRCm39) missense probably damaging 1.00
R8987:D630045J12Rik UTSW 6 38,173,898 (GRCm39) missense probably benign 0.11
R9052:D630045J12Rik UTSW 6 38,154,544 (GRCm39) missense probably damaging 1.00
R9264:D630045J12Rik UTSW 6 38,135,173 (GRCm39) missense probably benign 0.26
R9273:D630045J12Rik UTSW 6 38,167,512 (GRCm39) missense possibly damaging 0.88
R9431:D630045J12Rik UTSW 6 38,173,814 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ATGATGCCCTCAGACGTGAGAAAAG -3'
(R):5'- TTATCAGAGACTGTTCCCAGGTCCC -3'

Sequencing Primer
(F):5'- AGCTGACCAAGAAGTGCC -3'
(R):5'- GCGACAGCTTTTGATACAGC -3'
Posted On 2013-04-24