Mutagenetix > Incidental Mutations

Incidental Mutation 'R4244:Gm5174'

320351

Institutional Source

Beutler Lab

Gene Symbol

Gm5174

Ensembl Gene

ENSMUSG00000090308

Gene Name

predicted gene 5174

Synonyms

MMRRC Submission

041060-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R4244 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86655939-86657381 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to A at 86656280 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171131

SMART Domains

Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

Domain	Start	End	E-Value	Type
S_TKc	14	262	5.59e-86	SMART
UBA	276	313	1.28e-3	SMART
low complexity region	447	462	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219608

Meta Mutation Damage Score

0.1048

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (47/48)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	C	14: 8,482,521	T551A	probably benign	Het
Actr1b	T	C	1: 36,701,830	Y171C	possibly damaging	Het
Ap1g1	G	A	8: 109,833,490	S281N	probably benign	Het
Arfgef3	C	A	10: 18,630,420	G878V	probably damaging	Het
Ccdc137	T	C	11: 120,462,018	F196S	probably damaging	Het
Ccdc18	C	T	5: 108,148,972	Q214*	probably null	Het
Ccrl2	T	C	9: 111,055,354	I359V	probably benign	Het
Cdh20	C	T	1: 104,942,143	T196I	probably damaging	Het
Col6a3	G	T	1: 90,786,639	T1683K	unknown	Het
Copa	A	G	1: 172,110,718	I524V	probably benign	Het
Cyld	A	T	8: 88,730,755	R536*	probably null	Het
Dock10	T	A	1: 80,566,755	E905V	probably benign	Het
Dock5	A	G	14: 67,774,582	F1348L	probably benign	Het
Efcab3	A	T	11: 105,111,803	K5664I	probably damaging	Het
Gm9892	A	T	8: 52,196,400		noncoding transcript	Het
Grm4	A	G	17: 27,502,735	I144T	probably damaging	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Krt28	G	T	11: 99,374,550	S97Y	probably damaging	Het
Map3k6	T	C	4: 133,251,947	Y1204H	possibly damaging	Het
Mfsd2b	G	T	12: 4,874,356		probably benign	Het
Nav3	T	C	10: 109,769,296	D972G	probably damaging	Het
Olfr1167	T	C	2: 88,149,288	T244A	probably benign	Het
Olfr131	C	T	17: 38,082,430	V183I	probably benign	Het
Olfr319	T	G	11: 58,702,451	L250R	probably damaging	Het
Prex1	G	A	2: 166,570,336	R392W	probably damaging	Het
Ptpn5	C	T	7: 47,091,548	W38*	probably null	Het
Rab3gap1	T	C	1: 127,937,567		probably null	Het
Rfx7	A	G	9: 72,591,769	T72A	possibly damaging	Het
Scn7a	T	C	2: 66,742,001	I209V	probably benign	Het
Sh3d21	C	T	4: 126,150,718		probably benign	Het
Slc27a1	A	G	8: 71,584,973	T535A	probably benign	Het
Slc5a5	A	G	8: 70,890,286	V210A	probably benign	Het
Snx25	A	G	8: 46,105,254	C239R	probably damaging	Het
Sp5	T	C	2: 70,477,038	F356L	probably damaging	Het
Spaca9	T	C	2: 28,692,986	I141V	probably benign	Het
Tbcd	T	A	11: 121,594,281	L763H	probably damaging	Het
Thnsl1	A	G	2: 21,212,248	E271G	probably benign	Het
Vmn1r79	T	A	7: 12,177,044	C284*	probably null	Het
Vwa5a	T	C	9: 38,737,816		probably benign	Het
Zar1	T	C	5: 72,580,393	E121G	possibly damaging	Het
Zscan29	C	T	2: 121,164,794		probably null	Het

Other mutations in Gm5174

Allele	Source	Chr	Coord	Type	Predicted Effect
Laco	UTSW	10	86656108	unclassified	noncoding transcript
R1083:Gm5174	UTSW	10	86656108	unclassified	noncoding transcript
R1199:Gm5174	UTSW	10	86657325	unclassified	noncoding transcript
R1296:Gm5174	UTSW	10	86657002	unclassified	noncoding transcript
R1715:Gm5174	UTSW	10	86656912	unclassified	noncoding transcript
R1957:Gm5174	UTSW	10	86656753	unclassified	noncoding transcript
R2221:Gm5174	UTSW	10	86656508	unclassified	noncoding transcript
R2223:Gm5174	UTSW	10	86656508	unclassified	noncoding transcript
R3104:Gm5174	UTSW	10	86656655	unclassified	noncoding transcript
R4165:Gm5174	UTSW	10	86656933	unclassified	noncoding transcript
R4166:Gm5174	UTSW	10	86656933	unclassified	noncoding transcript
R4243:Gm5174	UTSW	10	86656280	unclassified	noncoding transcript
R5024:Gm5174	UTSW	10	86656587	unclassified	noncoding transcript
R5292:Gm5174	UTSW	10	86656698	unclassified	noncoding transcript
R5586:Gm5174	UTSW	10	86656545	unclassified	noncoding transcript
R5864:Gm5174	UTSW	10	86657181	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TTGCACCTGAAAACAGAGGC -3'
(R):5'- TATCTCTGGCGCCCAAAACC -3'

Sequencing Primer
(F):5'- CCCTGGTTGCCGTAAAAATG -3'
(R):5'- TGGCGCCCAAAACCTCTTG -3'

Posted On

2015-06-12