Incidental Mutation 'R4244:Krt28'
ID 320354
Institutional Source Beutler Lab
Gene Symbol Krt28
Ensembl Gene ENSMUSG00000055937
Gene Name keratin 28
Synonyms
MMRRC Submission 041060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R4244 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 99364872-99374903 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 99374550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Tyrosine at position 97 (S97Y)
Ref Sequence ENSEMBL: ENSMUSP00000006963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006963]
AlphaFold A6BLY7
Predicted Effect probably damaging
Transcript: ENSMUST00000006963
AA Change: S97Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006963
Gene: ENSMUSG00000055937
AA Change: S97Y

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Filament 83 398 4.6e-144 SMART
Meta Mutation Damage Score 0.2828 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,482,521 T551A probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Ap1g1 G A 8: 109,833,490 S281N probably benign Het
Arfgef3 C A 10: 18,630,420 G878V probably damaging Het
Ccdc137 T C 11: 120,462,018 F196S probably damaging Het
Ccdc18 C T 5: 108,148,972 Q214* probably null Het
Ccrl2 T C 9: 111,055,354 I359V probably benign Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Col6a3 G T 1: 90,786,639 T1683K unknown Het
Copa A G 1: 172,110,718 I524V probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dock5 A G 14: 67,774,582 F1348L probably benign Het
Efcab3 A T 11: 105,111,803 K5664I probably damaging Het
Gm5174 C A 10: 86,656,280 noncoding transcript Het
Gm9892 A T 8: 52,196,400 noncoding transcript Het
Grm4 A G 17: 27,502,735 I144T probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mfsd2b G T 12: 4,874,356 probably benign Het
Nav3 T C 10: 109,769,296 D972G probably damaging Het
Olfr1167 T C 2: 88,149,288 T244A probably benign Het
Olfr131 C T 17: 38,082,430 V183I probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Prex1 G A 2: 166,570,336 R392W probably damaging Het
Ptpn5 C T 7: 47,091,548 W38* probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sh3d21 C T 4: 126,150,718 probably benign Het
Slc27a1 A G 8: 71,584,973 T535A probably benign Het
Slc5a5 A G 8: 70,890,286 V210A probably benign Het
Snx25 A G 8: 46,105,254 C239R probably damaging Het
Sp5 T C 2: 70,477,038 F356L probably damaging Het
Spaca9 T C 2: 28,692,986 I141V probably benign Het
Tbcd T A 11: 121,594,281 L763H probably damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Vwa5a T C 9: 38,737,816 probably benign Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in Krt28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Krt28 APN 11 99371468 missense probably benign 0.00
IGL01568:Krt28 APN 11 99371417 missense probably damaging 1.00
IGL01590:Krt28 APN 11 99374394 critical splice donor site probably null
R1250:Krt28 UTSW 11 99366822 critical splice donor site probably null
R1488:Krt28 UTSW 11 99365171 missense probably benign 0.01
R2116:Krt28 UTSW 11 99365117 missense probably benign 0.27
R4862:Krt28 UTSW 11 99365110 missense possibly damaging 0.92
R4928:Krt28 UTSW 11 99374632 missense probably benign 0.00
R5035:Krt28 UTSW 11 99366824 missense probably benign 0.00
R5568:Krt28 UTSW 11 99371384 missense probably damaging 1.00
R5642:Krt28 UTSW 11 99374494 missense probably damaging 1.00
R5873:Krt28 UTSW 11 99366890 missense probably damaging 1.00
R6053:Krt28 UTSW 11 99371201 missense probably benign 0.05
R6548:Krt28 UTSW 11 99367013 missense probably damaging 1.00
R7194:Krt28 UTSW 11 99374404 nonsense probably null
R7863:Krt28 UTSW 11 99365173 missense possibly damaging 0.65
R7986:Krt28 UTSW 11 99366825 missense probably benign 0.00
R8415:Krt28 UTSW 11 99374800 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTAGTTTCAAGTTTGCGATTTACC -3'
(R):5'- ATACAGTCCGGATCCCTCAG -3'

Sequencing Primer
(F):5'- GCGATTTACCTTGCTTTTCAGG -3'
(R):5'- CAGGCTTTGCTGGGAGC -3'
Posted On 2015-06-12