Incidental Mutation 'R4244:Olfr131'
ID320362
Institutional Source Beutler Lab
Gene Symbol Olfr131
Ensembl Gene ENSMUSG00000043312
Gene Nameolfactory receptor 131
SynonymsGA_x6K02T2PSCP-2531299-2530355, MOR256-4
MMRRC Submission 041060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4244 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38081624-38088693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38082430 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 183 (V183I)
Ref Sequence ENSEMBL: ENSMUSP00000150562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059560] [ENSMUST00000172933] [ENSMUST00000215940] [ENSMUST00000216523]
Predicted Effect probably benign
Transcript: ENSMUST00000059560
AA Change: V183I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000061861
Gene: ENSMUSG00000043312
AA Change: V183I

DomainStartEndE-ValueType
Pfam:7tm_1 43 294 4e-35 PFAM
Pfam:7tm_4 141 287 2.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172933
AA Change: V183I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134532
Gene: ENSMUSG00000043312
AA Change: V183I

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 9.5e-57 PFAM
Pfam:7tm_1 43 294 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173218
Predicted Effect probably benign
Transcript: ENSMUST00000215940
AA Change: V183I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216523
AA Change: V183I

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,482,521 T551A probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Ap1g1 G A 8: 109,833,490 S281N probably benign Het
Arfgef3 C A 10: 18,630,420 G878V probably damaging Het
Ccdc137 T C 11: 120,462,018 F196S probably damaging Het
Ccdc18 C T 5: 108,148,972 Q214* probably null Het
Ccrl2 T C 9: 111,055,354 I359V probably benign Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Col6a3 G T 1: 90,786,639 T1683K unknown Het
Copa A G 1: 172,110,718 I524V probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dock5 A G 14: 67,774,582 F1348L probably benign Het
Efcab3 A T 11: 105,111,803 K5664I probably damaging Het
Gm5174 C A 10: 86,656,280 noncoding transcript Het
Gm9892 A T 8: 52,196,400 noncoding transcript Het
Grm4 A G 17: 27,502,735 I144T probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krt28 G T 11: 99,374,550 S97Y probably damaging Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mfsd2b G T 12: 4,874,356 probably benign Het
Nav3 T C 10: 109,769,296 D972G probably damaging Het
Olfr1167 T C 2: 88,149,288 T244A probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Prex1 G A 2: 166,570,336 R392W probably damaging Het
Ptpn5 C T 7: 47,091,548 W38* probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sh3d21 C T 4: 126,150,718 probably benign Het
Slc27a1 A G 8: 71,584,973 T535A probably benign Het
Slc5a5 A G 8: 70,890,286 V210A probably benign Het
Snx25 A G 8: 46,105,254 C239R probably damaging Het
Sp5 T C 2: 70,477,038 F356L probably damaging Het
Spaca9 T C 2: 28,692,986 I141V probably benign Het
Tbcd T A 11: 121,594,281 L763H probably damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Vwa5a T C 9: 38,737,816 probably benign Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in Olfr131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Olfr131 APN 17 38082653 missense possibly damaging 0.48
IGL01287:Olfr131 APN 17 38082107 missense probably damaging 1.00
IGL01637:Olfr131 APN 17 38082103 missense possibly damaging 0.90
IGL02833:Olfr131 APN 17 38082352 missense possibly damaging 0.84
IGL02927:Olfr131 APN 17 38082223 missense probably benign 0.00
R0662:Olfr131 UTSW 17 38082933 missense probably benign 0.09
R0755:Olfr131 UTSW 17 38082194 nonsense probably null
R1526:Olfr131 UTSW 17 38082595 missense probably damaging 0.99
R2155:Olfr131 UTSW 17 38082180 missense probably damaging 1.00
R3123:Olfr131 UTSW 17 38082012 utr 3 prime probably null
R3125:Olfr131 UTSW 17 38082012 utr 3 prime probably null
R4135:Olfr131 UTSW 17 38082357 missense possibly damaging 0.52
R5104:Olfr131 UTSW 17 38082283 missense possibly damaging 0.47
R5182:Olfr131 UTSW 17 38082114 missense probably benign 0.03
R5293:Olfr131 UTSW 17 38082240 missense probably damaging 1.00
R5738:Olfr131 UTSW 17 38082456 missense probably damaging 1.00
R5924:Olfr131 UTSW 17 38082363 missense probably benign 0.01
R6218:Olfr131 UTSW 17 38082729 missense probably damaging 0.98
R6362:Olfr131 UTSW 17 38082729 missense probably damaging 0.99
R6961:Olfr131 UTSW 17 38082205 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGACCCACATGTGTTAAAGGC -3'
(R):5'- AGAGTGTGTGCTTCTCTCCG -3'

Sequencing Primer
(F):5'- AAGGCCTTCTTTCGACCTTCAGAAG -3'
(R):5'- TGATCGCTATGTGGCCATC -3'
Posted On2015-06-12