Incidental Mutation 'R4245:Mtmr11'
ID320374
Institutional Source Beutler Lab
Gene Symbol Mtmr11
Ensembl Gene ENSMUSG00000045934
Gene Namemyotubularin related protein 11
Synonyms
MMRRC Submission 041061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R4245 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96162004-96171718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96168077 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 358 (C358S)
Ref Sequence ENSEMBL: ENSMUSP00000062341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054356] [ENSMUST00000076372] [ENSMUST00000129925]
Predicted Effect probably damaging
Transcript: ENSMUST00000054356
AA Change: C358S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062341
Gene: ENSMUSG00000045934
AA Change: C358S

DomainStartEndE-ValueType
Pfam:Myotub-related 191 323 1.7e-12 PFAM
Pfam:Myotub-related 312 488 1.3e-44 PFAM
Pfam:3-PAP 550 683 2.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076372
SMART Domains Protein: ENSMUSP00000075709
Gene: ENSMUSG00000068856

DomainStartEndE-ValueType
RRM 14 87 1.46e-25 SMART
RRM 101 175 5.07e-25 SMART
low complexity region 214 307 N/A INTRINSIC
low complexity region 310 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123520
Predicted Effect probably benign
Transcript: ENSMUST00000129925
SMART Domains Protein: ENSMUSP00000118258
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 162 264 4.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199721
Meta Mutation Damage Score 0.2939 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,782 noncoding transcript Het
4931408C20Rik T C 1: 26,682,080 N1340D probably benign Het
Acacb A T 5: 114,230,784 T1688S probably damaging Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
C8a A G 4: 104,876,346 V4A probably benign Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ccdc184 T A 15: 98,168,869 probably null Het
Cdc23 T C 18: 34,637,047 probably benign Het
Dnah5 A G 15: 28,219,189 N51S probably benign Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dusp27 T C 1: 166,101,116 E309G probably damaging Het
Eepd1 T C 9: 25,594,624 I460T probably benign Het
Fen1 T A 19: 10,200,367 I238F probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5493 A G 17: 22,747,226 E28G probably benign Het
Jakmip2 A G 18: 43,577,436 V234A probably benign Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mpeg1 C A 19: 12,462,908 Q577K probably damaging Het
Mthfd1 T C 12: 76,301,273 S564P probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Ndufs6 A T 13: 73,320,393 D62E probably damaging Het
Olfr18 T C 9: 20,314,333 I196V possibly damaging Het
Olfr313 T C 11: 58,817,778 Y257H probably damaging Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Phactr3 G A 2: 178,283,189 probably null Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk2 C T 15: 73,231,976 G749D probably benign Het
Rab3il1 A T 19: 10,030,154 D222V probably damaging Het
Radil T C 5: 142,543,791 D50G probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sf3a1 C T 11: 4,167,774 R179C probably damaging Het
Tg T C 15: 66,696,469 V1335A possibly damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vill T A 9: 119,071,291 probably benign Het
Vmn2r79 A G 7: 87,002,416 D341G possibly damaging Het
Wdr59 T C 8: 111,490,364 N272D possibly damaging Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zfp985 A G 4: 147,582,939 K88R probably damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in Mtmr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02539:Mtmr11 APN 3 96164991 intron probably benign
R1017:Mtmr11 UTSW 3 96164477 missense probably damaging 1.00
R1589:Mtmr11 UTSW 3 96168113 missense probably benign 0.16
R1836:Mtmr11 UTSW 3 96164786 missense probably damaging 0.98
R2264:Mtmr11 UTSW 3 96169097 missense possibly damaging 0.53
R3623:Mtmr11 UTSW 3 96165266 missense probably damaging 1.00
R4195:Mtmr11 UTSW 3 96167891 splice site probably benign
R4243:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4414:Mtmr11 UTSW 3 96167891 splice site probably benign
R4417:Mtmr11 UTSW 3 96167891 splice site probably benign
R4461:Mtmr11 UTSW 3 96167891 splice site probably benign
R4468:Mtmr11 UTSW 3 96167891 splice site probably benign
R4963:Mtmr11 UTSW 3 96163250 intron probably benign
R5134:Mtmr11 UTSW 3 96169907 missense probably damaging 1.00
R5154:Mtmr11 UTSW 3 96164319 missense probably benign 0.03
R5508:Mtmr11 UTSW 3 96163767 missense probably damaging 1.00
R5821:Mtmr11 UTSW 3 96167869 missense possibly damaging 0.91
R5868:Mtmr11 UTSW 3 96171202 missense possibly damaging 0.65
R5991:Mtmr11 UTSW 3 96168589 unclassified probably null
R6084:Mtmr11 UTSW 3 96168084 missense probably damaging 0.99
R6354:Mtmr11 UTSW 3 96168676 missense probably benign 0.07
R6446:Mtmr11 UTSW 3 96171188 missense probably benign 0.00
R6821:Mtmr11 UTSW 3 96170407 missense probably benign
R7033:Mtmr11 UTSW 3 96169946 missense probably damaging 1.00
R7312:Mtmr11 UTSW 3 96164538 missense possibly damaging 0.68
X0019:Mtmr11 UTSW 3 96164492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATGTCAGGTATGCCTAGCC -3'
(R):5'- AGGATGAATTGGCACTCACAGG -3'

Sequencing Primer
(F):5'- AGGTATGCCTAGCCTTCTAATCATGG -3'
(R):5'- TTGGCACTCACAGGAAGATGC -3'
Posted On2015-06-12