Incidental Mutation 'R4245:Olfr313'
ID320391
Institutional Source Beutler Lab
Gene Symbol Olfr313
Ensembl Gene ENSMUSG00000070438
Gene Nameolfactory receptor 313
SynonymsGA_x6K02T2NKPP-590035-589109, MOR222-2
MMRRC Submission 041061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4245 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58815000-58819450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58817778 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 257 (Y257H)
Ref Sequence ENSEMBL: ENSMUSP00000150529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082220] [ENSMUST00000217506]
Predicted Effect probably damaging
Transcript: ENSMUST00000082220
AA Change: Y257H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080852
Gene: ENSMUSG00000070438
AA Change: Y257H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 217 4.5e-9 PFAM
Pfam:7tm_1 39 288 5.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217506
AA Change: Y257H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.4526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,782 noncoding transcript Het
4931408C20Rik T C 1: 26,682,080 N1340D probably benign Het
Acacb A T 5: 114,230,784 T1688S probably damaging Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
C8a A G 4: 104,876,346 V4A probably benign Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ccdc184 T A 15: 98,168,869 probably null Het
Cdc23 T C 18: 34,637,047 probably benign Het
Dnah5 A G 15: 28,219,189 N51S probably benign Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dusp27 T C 1: 166,101,116 E309G probably damaging Het
Eepd1 T C 9: 25,594,624 I460T probably benign Het
Fen1 T A 19: 10,200,367 I238F probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5493 A G 17: 22,747,226 E28G probably benign Het
Jakmip2 A G 18: 43,577,436 V234A probably benign Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mpeg1 C A 19: 12,462,908 Q577K probably damaging Het
Mthfd1 T C 12: 76,301,273 S564P probably damaging Het
Mtmr11 T A 3: 96,168,077 C358S probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Ndufs6 A T 13: 73,320,393 D62E probably damaging Het
Olfr18 T C 9: 20,314,333 I196V possibly damaging Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Phactr3 G A 2: 178,283,189 probably null Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk2 C T 15: 73,231,976 G749D probably benign Het
Rab3il1 A T 19: 10,030,154 D222V probably damaging Het
Radil T C 5: 142,543,791 D50G probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sf3a1 C T 11: 4,167,774 R179C probably damaging Het
Tg T C 15: 66,696,469 V1335A possibly damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vill T A 9: 119,071,291 probably benign Het
Vmn2r79 A G 7: 87,002,416 D341G possibly damaging Het
Wdr59 T C 8: 111,490,364 N272D possibly damaging Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zfp985 A G 4: 147,582,939 K88R probably damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in Olfr313
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
FR4976:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
LCD18:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
R0269:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0617:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0707:Olfr313 UTSW 11 58817751 missense probably damaging 1.00
R2917:Olfr313 UTSW 11 58817488 missense probably damaging 1.00
R3085:Olfr313 UTSW 11 58817727 missense probably damaging 1.00
R4991:Olfr313 UTSW 11 58817718 missense probably damaging 1.00
R5188:Olfr313 UTSW 11 58817320 missense probably damaging 0.96
R6985:Olfr313 UTSW 11 58817113 missense probably damaging 0.98
R7076:Olfr313 UTSW 11 58817164 missense probably benign 0.17
R7253:Olfr313 UTSW 11 58817540 nonsense probably null
R7553:Olfr313 UTSW 11 58817060 missense probably benign 0.10
R8204:Olfr313 UTSW 11 58817059 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGAGACTGTCCTGCACTGAC -3'
(R):5'- CACTGTAGTCTTCAAGGTCTCAG -3'

Sequencing Primer
(F):5'- CTGACTACCATCTCAGTGAGGAG -3'
(R):5'- GTAGTCTTCAAGGTCTCAGTACTTTC -3'
Posted On2015-06-12