Incidental Mutation 'R4246:Kif14'
ID320404
Institutional Source Beutler Lab
Gene Symbol Kif14
Ensembl Gene ENSMUSG00000041498
Gene Namekinesin family member 14
SynonymsN-3 kinesin, D1Ertd367e
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136466343-136531511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136473388 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 492 (M492I)
Ref Sequence ENSEMBL: ENSMUSP00000139698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000195274] [ENSMUST00000201676]
PDB Structure
Crystal structure of the mouse Kif14 motor domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047817
AA Change: M442I

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: M442I

DomainStartEndE-ValueType
KISc 341 694 1.45e-180 SMART
FHA 809 861 1.46e-7 SMART
coiled coil region 911 1060 N/A INTRINSIC
low complexity region 1169 1179 N/A INTRINSIC
low complexity region 1548 1559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187963
Predicted Effect possibly damaging
Transcript: ENSMUST00000189413
AA Change: M492I

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: M492I

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 744 1.45e-180 SMART
FHA 859 911 1.46e-7 SMART
coiled coil region 961 1110 N/A INTRINSIC
low complexity region 1219 1229 N/A INTRINSIC
low complexity region 1598 1609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193587
Predicted Effect probably benign
Transcript: ENSMUST00000195274
SMART Domains Protein: ENSMUSP00000142040
Gene: ENSMUSG00000041498

DomainStartEndE-ValueType
Pfam:Kinesin 29 69 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201158
Predicted Effect probably benign
Transcript: ENSMUST00000201676
SMART Domains Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 497 3.7e-6 SMART
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Kif14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00159:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00160:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00164:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00310:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00330:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00335:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00434:Kif14 APN 1 136469018 missense probably benign 0.11
IGL00468:Kif14 APN 1 136469018 missense probably benign 0.11
IGL01330:Kif14 APN 1 136476374 missense probably damaging 0.99
IGL01530:Kif14 APN 1 136478419 splice site probably benign
IGL01622:Kif14 APN 1 136497356 splice site probably benign
IGL01689:Kif14 APN 1 136519642 missense probably damaging 0.99
IGL02115:Kif14 APN 1 136496567 splice site probably benign
IGL02252:Kif14 APN 1 136478392 missense probably damaging 1.00
IGL02259:Kif14 APN 1 136500102 missense probably benign
IGL02439:Kif14 APN 1 136490261 missense probably damaging 1.00
IGL02590:Kif14 APN 1 136496004 missense probably benign 0.00
IGL02606:Kif14 APN 1 136496593 missense probably damaging 1.00
IGL03253:Kif14 APN 1 136487460 missense probably damaging 0.97
R0106:Kif14 UTSW 1 136479924 splice site probably benign
R0193:Kif14 UTSW 1 136468438 missense probably benign 0.00
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0238:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0239:Kif14 UTSW 1 136527393 missense probably damaging 0.99
R0329:Kif14 UTSW 1 136496026 splice site probably benign
R0346:Kif14 UTSW 1 136468160 missense probably damaging 1.00
R0393:Kif14 UTSW 1 136482418 missense probably damaging 1.00
R0519:Kif14 UTSW 1 136469147 missense probably damaging 1.00
R0590:Kif14 UTSW 1 136482472 missense probably damaging 0.97
R0633:Kif14 UTSW 1 136527305 missense probably damaging 0.96
R0657:Kif14 UTSW 1 136469102 missense probably benign 0.07
R0831:Kif14 UTSW 1 136525871 splice site probably benign
R0971:Kif14 UTSW 1 136519654 missense probably damaging 0.98
R1018:Kif14 UTSW 1 136495841 splice site probably benign
R1520:Kif14 UTSW 1 136503324 missense probably benign 0.00
R1713:Kif14 UTSW 1 136527464 missense probably benign 0.00
R1728:Kif14 UTSW 1 136468279 missense probably benign
R1728:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1728:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1728:Kif14 UTSW 1 136490332 missense probably benign
R1728:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1728:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1728:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1729:Kif14 UTSW 1 136468279 missense probably benign
R1729:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1729:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1729:Kif14 UTSW 1 136490332 missense probably benign
R1729:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1729:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1729:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1730:Kif14 UTSW 1 136468279 missense probably benign
R1730:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1730:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1730:Kif14 UTSW 1 136490332 missense probably benign
R1730:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1730:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1730:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1739:Kif14 UTSW 1 136468279 missense probably benign
R1739:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1739:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1739:Kif14 UTSW 1 136490332 missense probably benign
R1739:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1739:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1739:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1762:Kif14 UTSW 1 136468279 missense probably benign
R1762:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1762:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1762:Kif14 UTSW 1 136490332 missense probably benign
R1762:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1762:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1762:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1783:Kif14 UTSW 1 136468279 missense probably benign
R1783:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1783:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1783:Kif14 UTSW 1 136490332 missense probably benign
R1783:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1783:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1783:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1784:Kif14 UTSW 1 136468279 missense probably benign
R1784:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1784:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1784:Kif14 UTSW 1 136490332 missense probably benign
R1784:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1784:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1784:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1785:Kif14 UTSW 1 136468279 missense probably benign
R1785:Kif14 UTSW 1 136468975 missense probably damaging 1.00
R1785:Kif14 UTSW 1 136478365 missense probably benign 0.00
R1785:Kif14 UTSW 1 136490332 missense probably benign
R1785:Kif14 UTSW 1 136503431 missense probably benign 0.10
R1785:Kif14 UTSW 1 136515961 missense probably benign 0.04
R1785:Kif14 UTSW 1 136525783 missense probably benign 0.03
R1872:Kif14 UTSW 1 136486358 missense probably damaging 1.00
R2049:Kif14 UTSW 1 136487080 missense probably benign
R2049:Kif14 UTSW 1 136510167 missense possibly damaging 0.68
R2268:Kif14 UTSW 1 136519748 nonsense probably null
R2373:Kif14 UTSW 1 136479845 missense probably damaging 1.00
R3076:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3077:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R3078:Kif14 UTSW 1 136519645 missense possibly damaging 0.51
R4232:Kif14 UTSW 1 136516363 nonsense probably null
R4247:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4250:Kif14 UTSW 1 136473388 missense possibly damaging 0.80
R4672:Kif14 UTSW 1 136521278 missense probably benign 0.00
R4672:Kif14 UTSW 1 136521279 missense probably benign
R4890:Kif14 UTSW 1 136487130 missense possibly damaging 0.91
R4994:Kif14 UTSW 1 136482959 missense probably damaging 1.00
R5102:Kif14 UTSW 1 136516403 missense probably benign 0.00
R5185:Kif14 UTSW 1 136527469 nonsense probably null
R5201:Kif14 UTSW 1 136503407 missense probably benign 0.00
R5399:Kif14 UTSW 1 136503324 missense probably benign 0.00
R5431:Kif14 UTSW 1 136496695 missense possibly damaging 0.91
R5932:Kif14 UTSW 1 136516390 missense probably benign 0.23
R6027:Kif14 UTSW 1 136483059 intron probably null
R6246:Kif14 UTSW 1 136476424 nonsense probably null
R6331:Kif14 UTSW 1 136515986 missense probably null 1.00
R6448:Kif14 UTSW 1 136503347 missense probably damaging 0.99
R6453:Kif14 UTSW 1 136482304 intron probably null
R6475:Kif14 UTSW 1 136527411 missense probably damaging 1.00
R6631:Kif14 UTSW 1 136515959 missense probably benign 0.39
R6713:Kif14 UTSW 1 136525806 missense probably benign
R7173:Kif14 UTSW 1 136479170 missense probably damaging 0.98
R7174:Kif14 UTSW 1 136521257 missense possibly damaging 0.67
R7241:Kif14 UTSW 1 136468753 missense probably benign 0.41
X0021:Kif14 UTSW 1 136490276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGCTTCGATGAGGCAGG -3'
(R):5'- AGGACCCTGCAGTGTTTAGC -3'

Sequencing Primer
(F):5'- GTTTGGTTCCTGAGCCTAGAGTC -3'
(R):5'- GCTAAGTCTGTGCACCTAATTG -3'
Posted On2015-06-12