Incidental Mutation 'R4246:Ak1'
ID320407
Institutional Source Beutler Lab
Gene Symbol Ak1
Ensembl Gene ENSMUSG00000026817
Gene Nameadenylate kinase 1
SynonymsAk-1, B430205N08Rik
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32621758-32635058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32633372 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 151 (T151A)
Ref Sequence ENSEMBL: ENSMUSP00000068479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068271] [ENSMUST00000113277] [ENSMUST00000113278] [ENSMUST00000156578] [ENSMUST00000195721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068271
AA Change: T151A

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068479
Gene: ENSMUSG00000026817
AA Change: T151A

DomainStartEndE-ValueType
Pfam:AAA_33 26 173 2.7e-10 PFAM
Pfam:AAA_17 26 194 5.4e-8 PFAM
Pfam:ADK 29 185 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113277
AA Change: T135A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108902
Gene: ENSMUSG00000026817
AA Change: T135A

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113278
AA Change: T135A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108903
Gene: ENSMUSG00000026817
AA Change: T135A

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135392
Predicted Effect probably benign
Transcript: ENSMUST00000156578
SMART Domains Protein: ENSMUSP00000123534
Gene: ENSMUSG00000026817

DomainStartEndE-ValueType
Pfam:AAA_17 10 86 1.5e-10 PFAM
Pfam:ADK 13 89 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195721
SMART Domains Protein: ENSMUSP00000142174
Gene: ENSMUSG00000026817

DomainStartEndE-ValueType
Pfam:ADK 13 96 2e-32 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adenylate kinase enzyme involved in energy metabolism and homeostasis of cellular adenine nucleotide ratios in different intracellular compartments. This gene is highly expressed in skeletal muscle, brain and erythrocytes. Certain mutations in this gene resulting in a functionally inadequate enzyme are associated with a rare genetic disorder causing nonspherocytic hemolytic anemia. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased adenosine triphosphate (ATP) turnover and reduced efficiency of ATP utilization during muscle contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Ak1 APN 2 32633495 unclassified probably benign
R1472:Ak1 UTSW 2 32630301 missense probably damaging 1.00
R1476:Ak1 UTSW 2 32633466 missense probably benign
R1876:Ak1 UTSW 2 32630270 missense probably damaging 0.99
R2004:Ak1 UTSW 2 32629610 missense probably benign
R4067:Ak1 UTSW 2 32629581 missense probably benign 0.05
R4873:Ak1 UTSW 2 32631177 missense probably benign 0.28
R4875:Ak1 UTSW 2 32631177 missense probably benign 0.28
R5076:Ak1 UTSW 2 32633448 missense probably damaging 1.00
R6187:Ak1 UTSW 2 32633477 missense probably damaging 0.99
R6458:Ak1 UTSW 2 32630373 missense probably damaging 1.00
R6818:Ak1 UTSW 2 32630373 missense probably damaging 1.00
R6917:Ak1 UTSW 2 32631152 missense possibly damaging 0.86
R6919:Ak1 UTSW 2 32631122 missense possibly damaging 0.62
Z1088:Ak1 UTSW 2 32630271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTCTAGGAGCCCGTGGAAG -3'
(R):5'- AGAGGGATGGCCTAAGATCC -3'

Sequencing Primer
(F):5'- TACTCTAGGAAGGCGCGTTC -3'
(R):5'- TAAGATCCCACCGTGAGCTG -3'
Posted On2015-06-12