Incidental Mutation 'R0396:Vmn2r28'
ID 32041
Institutional Source Beutler Lab
Gene Symbol Vmn2r28
Ensembl Gene ENSMUSG00000066820
Gene Name vomeronasal 2, receptor 28
Synonyms EG665255
MMRRC Submission 038602-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R0396 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 5483455-5496850 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5491513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 245 (I245L)
Ref Sequence ENSEMBL: ENSMUSP00000083477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086297]
AlphaFold L7N203
Predicted Effect probably benign
Transcript: ENSMUST00000086297
AA Change: I245L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820
AA Change: I245L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.7e-26 PFAM
Pfam:NCD3G 512 565 9.8e-21 PFAM
Pfam:7tm_3 598 833 2.8e-56 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik G A 8: 106,436,412 (GRCm39) V194I probably benign Het
Acsm1 A T 7: 119,235,678 (GRCm39) I133F probably damaging Het
Adamts9 T A 6: 92,774,986 (GRCm39) T1676S probably benign Het
Adcy4 T C 14: 56,009,745 (GRCm39) D769G probably benign Het
Aif1 T C 17: 35,390,085 (GRCm39) *148W probably null Het
Akna C T 4: 63,310,363 (GRCm39) probably benign Het
Arhgap32 G A 9: 32,156,551 (GRCm39) probably null Het
Atpaf1 G A 4: 115,642,449 (GRCm39) E92K possibly damaging Het
Bltp2 T C 11: 78,159,203 (GRCm39) V467A possibly damaging Het
C1s1 T C 6: 124,510,313 (GRCm39) E378G probably benign Het
Caprin1 T A 2: 103,599,914 (GRCm39) Q108L probably damaging Het
Car13 A T 3: 14,721,299 (GRCm39) H154L probably benign Het
Cdon C A 9: 35,381,426 (GRCm39) N605K probably damaging Het
Ceacam10 G A 7: 24,480,439 (GRCm39) G70E probably damaging Het
Cfap221 G A 1: 119,881,930 (GRCm39) T286M probably benign Het
Cfap61 T C 2: 145,791,864 (GRCm39) F107S possibly damaging Het
Coil C A 11: 88,872,449 (GRCm39) T270N probably benign Het
Crocc2 T G 1: 93,151,936 (GRCm39) probably benign Het
Crot T C 5: 9,019,959 (GRCm39) E461G probably damaging Het
D130052B06Rik G T 11: 33,573,391 (GRCm39) R41L unknown Het
D630045J12Rik T C 6: 38,173,671 (GRCm39) S166G possibly damaging Het
Dennd4a T G 9: 64,769,673 (GRCm39) V460G probably damaging Het
Depdc7 A T 2: 104,557,668 (GRCm39) probably benign Het
Dgkb G A 12: 38,240,134 (GRCm39) probably null Het
Dhx57 T G 17: 80,582,226 (GRCm39) S407R probably benign Het
Dnase2a G T 8: 85,636,392 (GRCm39) probably benign Het
Dqx1 T G 6: 83,035,986 (GRCm39) M106R probably benign Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Ephx2 T G 14: 66,345,512 (GRCm39) I151L probably benign Het
Gdf3 C T 6: 122,584,094 (GRCm39) G91D probably damaging Het
Gpc5 T A 14: 115,665,620 (GRCm39) N481K possibly damaging Het
Gsdme T A 6: 50,198,087 (GRCm39) H291L probably benign Het
H2-T13 A G 17: 36,394,614 (GRCm39) I103T possibly damaging Het
Hif3a G A 7: 16,785,946 (GRCm39) probably benign Het
Hmox2 A T 16: 4,583,627 (GRCm39) I232L probably benign Het
Itgb2 A G 10: 77,397,023 (GRCm39) Y686C probably damaging Het
Jmjd1c A G 10: 67,055,302 (GRCm39) T528A possibly damaging Het
Kdr T C 5: 76,121,388 (GRCm39) I541V possibly damaging Het
Khdrbs2 C A 1: 32,559,054 (GRCm39) V343L probably damaging Het
Kif16b C T 2: 142,695,579 (GRCm39) R175H probably damaging Het
Klri2 T G 6: 129,717,251 (GRCm39) E44A possibly damaging Het
Kmt2b G T 7: 30,276,180 (GRCm39) T1773K probably damaging Het
Lair1 A G 7: 4,013,785 (GRCm39) L154P probably damaging Het
Larp1b G A 3: 40,924,996 (GRCm39) V158M probably damaging Het
Lgi3 T A 14: 70,772,280 (GRCm39) I275N probably damaging Het
Lrba A G 3: 86,202,486 (GRCm39) N246D probably damaging Het
Lrrc45 T A 11: 120,605,733 (GRCm39) probably benign Het
Mdh2 G T 5: 135,818,533 (GRCm39) V263L probably benign Het
Myom1 T A 17: 71,341,688 (GRCm39) V149E probably damaging Het
Nanos1 A T 19: 60,745,479 (GRCm39) D259V probably damaging Het
Nedd4l T A 18: 65,294,725 (GRCm39) probably benign Het
Npas3 A G 12: 53,878,528 (GRCm39) Y150C probably damaging Het
Or10ab4 A T 7: 107,655,170 (GRCm39) H327L probably benign Het
Or10ag59 T A 2: 87,405,911 (GRCm39) V161D possibly damaging Het
Or2h1b C T 17: 37,462,446 (GRCm39) C139Y probably damaging Het
Or2y1f A T 11: 49,184,165 (GRCm39) I6F probably benign Het
Or52e15 G A 7: 104,645,913 (GRCm39) A66V probably damaging Het
Or8k28 T C 2: 86,286,363 (GRCm39) N84S possibly damaging Het
Pde4c A G 8: 71,202,725 (GRCm39) N637S probably benign Het
Pds5b T A 5: 150,702,740 (GRCm39) V824D possibly damaging Het
Pole2 A T 12: 69,269,160 (GRCm39) probably benign Het
Ppig C T 2: 69,566,320 (GRCm39) probably benign Het
Prep A G 10: 44,968,772 (GRCm39) Y90C probably damaging Het
Proca1 A T 11: 78,085,731 (GRCm39) R11S probably damaging Het
Prph T A 15: 98,954,872 (GRCm39) W313R probably benign Het
Prune2 C T 19: 17,100,444 (GRCm39) P1983S probably benign Het
Ptbp2 G A 3: 119,517,847 (GRCm39) probably benign Het
Rsph6a C T 7: 18,808,031 (GRCm39) P398L probably damaging Het
Sdk2 T C 11: 113,720,793 (GRCm39) I1379V probably benign Het
Sf3b1 C T 1: 55,058,430 (GRCm39) G53E probably damaging Het
Slc9a3 T C 13: 74,305,903 (GRCm39) probably null Het
Smarcal1 A T 1: 72,665,632 (GRCm39) H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,059,142 (GRCm39) probably benign Het
Sptan1 T C 2: 29,881,045 (GRCm39) V438A probably damaging Het
Sstr4 T A 2: 148,238,181 (GRCm39) V264D probably damaging Het
Susd2 A G 10: 75,475,745 (GRCm39) L418P probably damaging Het
Synj1 A G 16: 90,735,528 (GRCm39) V1475A probably benign Het
Szt2 G A 4: 118,233,544 (GRCm39) probably benign Het
Tbc1d4 T C 14: 101,695,499 (GRCm39) probably null Het
Tesk1 A G 4: 43,446,000 (GRCm39) E311G probably damaging Het
Tmed5 A T 5: 108,273,882 (GRCm39) V119E probably damaging Het
Tmem260 T C 14: 48,724,324 (GRCm39) S201P possibly damaging Het
Tnxb A G 17: 34,890,707 (GRCm39) Y350C probably damaging Het
Tpte T C 8: 22,825,624 (GRCm39) probably benign Het
Trim37 A T 11: 87,037,794 (GRCm39) D161V probably damaging Het
Trrap C A 5: 144,751,366 (GRCm39) Q1640K probably damaging Het
Tspoap1 T C 11: 87,667,172 (GRCm39) probably benign Het
Ttk T A 9: 83,729,313 (GRCm39) probably benign Het
Vmn1r172 A G 7: 23,359,957 (GRCm39) S281G probably benign Het
Vmn1r177 A G 7: 23,565,022 (GRCm39) S285P probably damaging Het
Vmn1r231 C T 17: 21,110,661 (GRCm39) V85I probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r118 T C 17: 55,915,643 (GRCm39) I436V probably benign Het
Vmn2r12 T C 5: 109,240,765 (GRCm39) K116R probably benign Het
Wdr26 A T 1: 181,008,216 (GRCm39) probably benign Het
Xrcc3 A T 12: 111,776,391 (GRCm39) H67Q probably benign Het
Zbbx A T 3: 74,985,802 (GRCm39) S417T possibly damaging Het
Zc3h13 A G 14: 75,560,922 (GRCm39) D504G unknown Het
Zfp1005 G A 2: 150,109,973 (GRCm39) G221D probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zyg11b A T 4: 108,112,505 (GRCm39) F388I probably damaging Het
Other mutations in Vmn2r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Vmn2r28 APN 7 5,491,068 (GRCm39) missense probably benign 0.12
IGL01061:Vmn2r28 APN 7 5,491,183 (GRCm39) missense probably damaging 1.00
IGL01160:Vmn2r28 APN 7 5,489,477 (GRCm39) missense probably damaging 0.99
IGL01335:Vmn2r28 APN 7 5,484,087 (GRCm39) missense possibly damaging 0.67
IGL01532:Vmn2r28 APN 7 5,489,463 (GRCm39) missense probably benign 0.16
IGL01791:Vmn2r28 APN 7 5,491,161 (GRCm39) missense probably benign 0.00
IGL01875:Vmn2r28 APN 7 5,484,302 (GRCm39) missense probably benign 0.30
IGL02161:Vmn2r28 APN 7 5,491,123 (GRCm39) missense possibly damaging 0.88
IGL02499:Vmn2r28 APN 7 5,493,568 (GRCm39) missense probably damaging 0.98
IGL02858:Vmn2r28 APN 7 5,484,003 (GRCm39) missense probably damaging 0.99
IGL03061:Vmn2r28 APN 7 5,487,015 (GRCm39) missense probably damaging 0.98
G1patch:Vmn2r28 UTSW 7 5,491,408 (GRCm39) missense probably benign 0.13
R0288:Vmn2r28 UTSW 7 5,491,020 (GRCm39) missense probably damaging 1.00
R0361:Vmn2r28 UTSW 7 5,496,715 (GRCm39) missense probably benign 0.00
R0480:Vmn2r28 UTSW 7 5,493,456 (GRCm39) missense probably benign 0.00
R0485:Vmn2r28 UTSW 7 5,491,689 (GRCm39) missense probably damaging 1.00
R0837:Vmn2r28 UTSW 7 5,491,026 (GRCm39) missense probably damaging 0.99
R1282:Vmn2r28 UTSW 7 5,484,301 (GRCm39) missense probably damaging 0.99
R1296:Vmn2r28 UTSW 7 5,484,544 (GRCm39) missense possibly damaging 0.81
R1829:Vmn2r28 UTSW 7 5,496,810 (GRCm39) missense probably benign
R1853:Vmn2r28 UTSW 7 5,484,246 (GRCm39) nonsense probably null
R1869:Vmn2r28 UTSW 7 5,489,345 (GRCm39) missense probably benign 0.00
R1887:Vmn2r28 UTSW 7 5,491,288 (GRCm39) missense possibly damaging 0.90
R1961:Vmn2r28 UTSW 7 5,484,070 (GRCm39) missense possibly damaging 0.85
R1998:Vmn2r28 UTSW 7 5,491,313 (GRCm39) missense possibly damaging 0.87
R2392:Vmn2r28 UTSW 7 5,487,130 (GRCm39) missense probably damaging 0.98
R2432:Vmn2r28 UTSW 7 5,491,701 (GRCm39) missense probably damaging 0.99
R3055:Vmn2r28 UTSW 7 5,484,391 (GRCm39) missense probably damaging 0.98
R3753:Vmn2r28 UTSW 7 5,491,026 (GRCm39) missense probably damaging 0.99
R3877:Vmn2r28 UTSW 7 5,491,357 (GRCm39) missense probably damaging 1.00
R4307:Vmn2r28 UTSW 7 5,493,707 (GRCm39) missense probably damaging 0.99
R5023:Vmn2r28 UTSW 7 5,489,463 (GRCm39) missense probably benign 0.16
R5057:Vmn2r28 UTSW 7 5,489,463 (GRCm39) missense probably benign 0.16
R5083:Vmn2r28 UTSW 7 5,483,671 (GRCm39) missense possibly damaging 0.77
R5427:Vmn2r28 UTSW 7 5,489,376 (GRCm39) missense probably damaging 0.99
R5472:Vmn2r28 UTSW 7 5,490,943 (GRCm39) critical splice donor site probably null
R5511:Vmn2r28 UTSW 7 5,487,011 (GRCm39) missense possibly damaging 0.61
R5731:Vmn2r28 UTSW 7 5,491,668 (GRCm39) missense probably benign 0.41
R6091:Vmn2r28 UTSW 7 5,496,790 (GRCm39) missense possibly damaging 0.88
R6179:Vmn2r28 UTSW 7 5,491,003 (GRCm39) nonsense probably null
R6276:Vmn2r28 UTSW 7 5,493,730 (GRCm39) missense probably benign 0.01
R6441:Vmn2r28 UTSW 7 5,491,474 (GRCm39) missense probably benign 0.00
R6463:Vmn2r28 UTSW 7 5,489,435 (GRCm39) missense probably benign 0.07
R6528:Vmn2r28 UTSW 7 5,493,684 (GRCm39) missense probably benign 0.12
R6725:Vmn2r28 UTSW 7 5,491,408 (GRCm39) missense probably benign 0.13
R6760:Vmn2r28 UTSW 7 5,484,229 (GRCm39) missense probably damaging 0.97
R6849:Vmn2r28 UTSW 7 5,483,806 (GRCm39) missense probably damaging 1.00
R7110:Vmn2r28 UTSW 7 5,493,733 (GRCm39) missense probably benign 0.06
R7146:Vmn2r28 UTSW 7 5,484,495 (GRCm39) missense probably benign 0.05
R7407:Vmn2r28 UTSW 7 5,484,308 (GRCm39) missense probably damaging 1.00
R7563:Vmn2r28 UTSW 7 5,491,200 (GRCm39) missense probably benign 0.00
R7611:Vmn2r28 UTSW 7 5,484,255 (GRCm39) missense probably benign 0.02
R7808:Vmn2r28 UTSW 7 5,496,678 (GRCm39) missense probably damaging 0.98
R7862:Vmn2r28 UTSW 7 5,493,613 (GRCm39) missense probably benign 0.00
R7916:Vmn2r28 UTSW 7 5,483,818 (GRCm39) missense probably damaging 1.00
R8183:Vmn2r28 UTSW 7 5,491,147 (GRCm39) missense probably damaging 1.00
R8334:Vmn2r28 UTSW 7 5,487,059 (GRCm39) missense probably damaging 1.00
R8519:Vmn2r28 UTSW 7 5,489,347 (GRCm39) missense probably benign 0.31
R8989:Vmn2r28 UTSW 7 5,493,473 (GRCm39) missense probably benign 0.00
R9066:Vmn2r28 UTSW 7 5,491,596 (GRCm39) missense probably damaging 1.00
R9422:Vmn2r28 UTSW 7 5,483,747 (GRCm39) missense probably damaging 1.00
R9469:Vmn2r28 UTSW 7 5,487,118 (GRCm39) missense probably damaging 0.99
R9608:Vmn2r28 UTSW 7 5,491,220 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGAAATCTCAGCATGGTGGGGTAG -3'
(R):5'- ACATGTGCCAGGATTGAACATTTGC -3'

Sequencing Primer
(F):5'- GTAAAAGTCCCATAGAATGTGCC -3'
(R):5'- GATTGGATGCACTACACCTCG -3'
Posted On 2013-04-24