Incidental Mutation 'R4246:Mapkbp1'
ID320410
Institutional Source Beutler Lab
Gene Symbol Mapkbp1
Ensembl Gene ENSMUSG00000033902
Gene Namemitogen-activated protein kinase binding protein 1
Synonyms2810483F24Rik, Jnkbp1
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119972699-120027408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120013027 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 252 (I252N)
Ref Sequence ENSEMBL: ENSMUSP00000068516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066058] [ENSMUST00000229024]
Predicted Effect probably damaging
Transcript: ENSMUST00000066058
AA Change: I252N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068516
Gene: ENSMUSG00000033902
AA Change: I252N

DomainStartEndE-ValueType
WD40 80 121 8.75e-5 SMART
WD40 124 165 3.64e-2 SMART
WD40 168 205 4.62e-1 SMART
low complexity region 220 234 N/A INTRINSIC
WD40 264 301 2.65e1 SMART
WD40 332 367 1.99e0 SMART
WD40 374 422 1.29e-2 SMART
WD40 463 502 3.9e-2 SMART
WD40 505 547 2.77e-1 SMART
WD40 551 592 2.67e-1 SMART
WD40 599 639 2.21e1 SMART
WD40 642 684 5.75e-1 SMART
WD40 687 726 6.04e-8 SMART
low complexity region 736 747 N/A INTRINSIC
low complexity region 779 795 N/A INTRINSIC
low complexity region 1028 1054 N/A INTRINSIC
coiled coil region 1400 1427 N/A INTRINSIC
low complexity region 1460 1477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184907
Predicted Effect probably damaging
Transcript: ENSMUST00000229024
AA Change: I252N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Mapkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mapkbp1 APN 2 120021858 missense possibly damaging 0.94
IGL01309:Mapkbp1 APN 2 120018942 missense probably damaging 1.00
IGL01728:Mapkbp1 APN 2 120023821 missense probably damaging 1.00
IGL01808:Mapkbp1 APN 2 120023169 unclassified probably null
IGL02185:Mapkbp1 APN 2 120014663 missense possibly damaging 0.58
IGL02421:Mapkbp1 APN 2 120019655 missense possibly damaging 0.95
IGL02691:Mapkbp1 APN 2 119973174 splice site probably benign
IGL03146:Mapkbp1 APN 2 119998474 splice site probably benign
IGL03387:Mapkbp1 APN 2 119998498 missense probably damaging 0.99
IGL03054:Mapkbp1 UTSW 2 120015400 missense probably damaging 0.97
R0118:Mapkbp1 UTSW 2 120025215 missense probably benign 0.00
R0393:Mapkbp1 UTSW 2 120012903 splice site probably null
R0463:Mapkbp1 UTSW 2 120023151 missense probably benign 0.01
R0788:Mapkbp1 UTSW 2 120024001 missense probably benign 0.02
R0928:Mapkbp1 UTSW 2 120015368 missense probably benign 0.00
R1104:Mapkbp1 UTSW 2 120011073 splice site probably benign
R1162:Mapkbp1 UTSW 2 120025318 missense possibly damaging 0.87
R1219:Mapkbp1 UTSW 2 120019350 nonsense probably null
R1299:Mapkbp1 UTSW 2 120015404 missense probably damaging 1.00
R1300:Mapkbp1 UTSW 2 120013655 missense probably benign 0.25
R1342:Mapkbp1 UTSW 2 119998534 missense possibly damaging 0.95
R1456:Mapkbp1 UTSW 2 119973145 missense probably damaging 1.00
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1660:Mapkbp1 UTSW 2 120018548 missense possibly damaging 0.83
R2008:Mapkbp1 UTSW 2 120012665 missense probably damaging 1.00
R2083:Mapkbp1 UTSW 2 120015482 missense possibly damaging 0.96
R2371:Mapkbp1 UTSW 2 120010780 missense probably damaging 1.00
R2423:Mapkbp1 UTSW 2 120024590 missense probably benign 0.00
R3976:Mapkbp1 UTSW 2 120021858 missense possibly damaging 0.94
R4009:Mapkbp1 UTSW 2 120023605 missense probably benign 0.00
R4183:Mapkbp1 UTSW 2 120017865 missense probably damaging 1.00
R4503:Mapkbp1 UTSW 2 120015706 missense probably damaging 1.00
R4513:Mapkbp1 UTSW 2 120023693 missense possibly damaging 0.63
R4517:Mapkbp1 UTSW 2 120025064 intron probably benign
R4742:Mapkbp1 UTSW 2 120016818 missense probably damaging 1.00
R5049:Mapkbp1 UTSW 2 120015501 splice site probably benign
R5079:Mapkbp1 UTSW 2 120013733 missense probably damaging 0.99
R5137:Mapkbp1 UTSW 2 120022181 missense probably damaging 1.00
R5255:Mapkbp1 UTSW 2 120017254 missense probably damaging 1.00
R5530:Mapkbp1 UTSW 2 120015355 missense probably benign
R5546:Mapkbp1 UTSW 2 120019243 missense probably damaging 1.00
R5634:Mapkbp1 UTSW 2 119973095 missense probably damaging 1.00
R5696:Mapkbp1 UTSW 2 120021720 splice site probably null
R5891:Mapkbp1 UTSW 2 120023932 nonsense probably null
R6263:Mapkbp1 UTSW 2 120023291 missense probably damaging 1.00
R6807:Mapkbp1 UTSW 2 120021159 missense probably damaging 0.99
R6890:Mapkbp1 UTSW 2 120015802 missense probably damaging 1.00
R7159:Mapkbp1 UTSW 2 120025132 missense possibly damaging 0.72
R7467:Mapkbp1 UTSW 2 120022188 missense probably damaging 1.00
R7536:Mapkbp1 UTSW 2 120018585 missense probably damaging 1.00
R7564:Mapkbp1 UTSW 2 120013751 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGTTCTTCATGGACCTGACC -3'
(R):5'- CCCTTCAGCATGCACAAAGG -3'

Sequencing Primer
(F):5'- GCGTCTCAAAGAACACATGCTTG -3'
(R):5'- GCATGCACAAAGGCCCAG -3'
Posted On2015-06-12