Incidental Mutation 'R4246:Nr4a3'
ID320416
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48083125 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 553 (P553S)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030025
AA Change: P553S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: P553S

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect unknown
Transcript: ENSMUST00000153369
AA Change: P582S
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: P582S

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7986:Nr4a3 UTSW 4 48055954 missense probably damaging 1.00
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8403:Nr4a3 UTSW 4 48051348 missense probably damaging 1.00
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ACATCAGTGATTTCCACCCC -3'
(R):5'- GTACCAAGTCCTCTAGCTTCAGG -3'

Sequencing Primer
(F):5'- TCCTGTATCAAGCCAAGTGG -3'
(R):5'- TTCAGGTAGAAGATGCGCTG -3'
Posted On2015-06-12