Incidental Mutation 'R4246:Sumf1'
ID320422
Institutional Source Beutler Lab
Gene Symbol Sumf1
Ensembl Gene ENSMUSG00000030101
Gene Namesulfatase modifying factor 1
Synonyms
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location108107028-108185582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108155013 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 156 (V156G)
Ref Sequence ENSEMBL: ENSMUSP00000127537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032191] [ENSMUST00000167338] [ENSMUST00000172188]
Predicted Effect probably damaging
Transcript: ENSMUST00000032191
AA Change: V181G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032191
Gene: ENSMUSG00000030101
AA Change: V181G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 365 1.4e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167338
AA Change: V156G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127537
Gene: ENSMUSG00000030101
AA Change: V156G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 340 1.2e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171697
Predicted Effect probably benign
Transcript: ENSMUST00000172188
SMART Domains Protein: ENSMUSP00000132321
Gene: ENSMUSG00000030101

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 149 9.5e-18 PFAM
Pfam:FGE-sulfatase 144 233 4.9e-30 PFAM
Meta Mutation Damage Score 0.9032 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes lacking all sulfatase activities exhibit frequent early postnatal lethality and growth retardation, skeletal anomalies, neurological defects, and massive GAG accumulation and cell vacuolization in all tissues in association with systemic inflammation, apoptosis, and neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Sumf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Sumf1 APN 6 108176016 missense probably damaging 1.00
IGL01624:Sumf1 APN 6 108153201 missense probably damaging 1.00
IGL02146:Sumf1 APN 6 108173431 critical splice acceptor site probably null
R0594:Sumf1 UTSW 6 108173414 missense probably benign 0.31
R0633:Sumf1 UTSW 6 108144671 missense probably damaging 1.00
R1479:Sumf1 UTSW 6 108176058 missense probably damaging 1.00
R3036:Sumf1 UTSW 6 108153191 missense possibly damaging 0.92
R3054:Sumf1 UTSW 6 108153204 missense probably benign 0.14
R4247:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4249:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4574:Sumf1 UTSW 6 108108432 unclassified probably benign
R4853:Sumf1 UTSW 6 108185495 missense probably benign 0.00
R5146:Sumf1 UTSW 6 108185310 missense probably benign 0.12
R5764:Sumf1 UTSW 6 108118463 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTGGCTGATTATACCTGCC -3'
(R):5'- ATCCCTGTAGCTATGTGGCAC -3'

Sequencing Primer
(F):5'- ACCTGCCATTCATTTTACATATGAAG -3'
(R):5'- GGTCACATGTAAGTCTATGGCAC -3'
Posted On2015-06-12