Incidental Mutation 'R4246:Lrfn1'
ID320425
Institutional Source Beutler Lab
Gene Symbol Lrfn1
Ensembl Gene ENSMUSG00000030600
Gene Nameleucine rich repeat and fibronectin type III domain containing 1
SynonymsSALM2
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28451980-28468242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 28459942 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 429 (V429L)
Ref Sequence ENSEMBL: ENSMUSP00000139609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000055110] [ENSMUST00000108288] [ENSMUST00000189877] [ENSMUST00000190954]
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055110
AA Change: V429L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057645
Gene: ENSMUSG00000030600
AA Change: V429L

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108288
AA Change: V429L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103923
Gene: ENSMUSG00000030600
AA Change: V429L

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
FN3 422 502 2.68e-2 SMART
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 730 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189877
AA Change: V429L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139609
Gene: ENSMUSG00000030600
AA Change: V429L

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190954
SMART Domains Protein: ENSMUSP00000140537
Gene: ENSMUSG00000030600

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Blast:LRRNT 33 69 2e-18 BLAST
LRR 88 111 3.7e-3 SMART
LRR 112 135 1.9e-2 SMART
LRR_TYP 136 159 7.1e-6 SMART
LRR 161 184 1.1e-1 SMART
LRR 185 208 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191267
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Lrfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Lrfn1 APN 7 28460017 missense probably damaging 1.00
IGL01565:Lrfn1 APN 7 28458769 missense probably damaging 1.00
IGL01622:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL01623:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL02176:Lrfn1 APN 7 28458686 intron probably benign
IGL02642:Lrfn1 APN 7 28458688 intron probably benign
R1123:Lrfn1 UTSW 7 28467119 missense possibly damaging 0.71
R1838:Lrfn1 UTSW 7 28459768 missense probably damaging 0.98
R3000:Lrfn1 UTSW 7 28467407 missense probably damaging 1.00
R3551:Lrfn1 UTSW 7 28460054 missense possibly damaging 0.90
R3905:Lrfn1 UTSW 7 28466869 missense possibly damaging 0.49
R5621:Lrfn1 UTSW 7 28466836 missense probably damaging 1.00
R6267:Lrfn1 UTSW 7 28459744 missense probably benign 0.01
R6902:Lrfn1 UTSW 7 28459813 missense probably benign 0.10
R7059:Lrfn1 UTSW 7 28466930 missense possibly damaging 0.65
R7073:Lrfn1 UTSW 7 28459972 missense possibly damaging 0.94
R7208:Lrfn1 UTSW 7 28467139 missense probably benign
R7402:Lrfn1 UTSW 7 28459522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCATAGCCTCCAATGCTGC -3'
(R):5'- AGCTGGAACTAAGCAAGGTC -3'

Sequencing Primer
(F):5'- TCCAATGCTGCGGGGGAAG -3'
(R):5'- CTGGAACTAAGCAAGGTCAAGGG -3'
Posted On2015-06-12