Incidental Mutation 'R4246:Olfr957'
ID320429
Institutional Source Beutler Lab
Gene Symbol Olfr957
Ensembl Gene ENSMUSG00000095322
Gene Nameolfactory receptor 957
SynonymsGA_x6K02T2PVTD-33208209-33207274, MOR171-12
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39510234-39515809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39511603 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 39 (V39A)
Ref Sequence ENSEMBL: ENSMUSP00000149559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051653] [ENSMUST00000216177]
Predicted Effect probably benign
Transcript: ENSMUST00000051653
AA Change: V39A

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054536
Gene: ENSMUSG00000095322
AA Change: V39A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-50 PFAM
Pfam:7tm_1 41 290 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216177
AA Change: V39A

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Olfr957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr957 APN 9 39511046 missense possibly damaging 0.64
R0603:Olfr957 UTSW 9 39511514 missense possibly damaging 0.76
R1642:Olfr957 UTSW 9 39511354 missense possibly damaging 0.78
R2044:Olfr957 UTSW 9 39511378 missense probably damaging 0.99
R2182:Olfr957 UTSW 9 39511426 missense probably damaging 1.00
R2290:Olfr957 UTSW 9 39511678 missense possibly damaging 0.87
R4248:Olfr957 UTSW 9 39511603 missense probably benign 0.31
R5273:Olfr957 UTSW 9 39511499 missense possibly damaging 0.95
R5495:Olfr957 UTSW 9 39511145 missense probably benign 0.39
R5718:Olfr957 UTSW 9 39511042 missense probably damaging 1.00
R5827:Olfr957 UTSW 9 39511058 missense probably damaging 1.00
R6261:Olfr957 UTSW 9 39510809 missense probably benign
R6917:Olfr957 UTSW 9 39511199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGTGACACTCCGAAACAG -3'
(R):5'- GTAAAAGCACAGTAAGCACCTGTC -3'

Sequencing Primer
(F):5'- GTAAAACTGAGCCATGCATTCTGC -3'
(R):5'- GCACAGTAAGCACCTGTCTTAAAAAC -3'
Posted On2015-06-12