Incidental Mutation 'R4246:Trhr'
ID320437
Institutional Source Beutler Lab
Gene Symbol Trhr
Ensembl Gene ENSMUSG00000038760
Gene Namethyrotropin releasing hormone receptor
SynonymsTRH-R1
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location44196135-44235912 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 44233460 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038856] [ENSMUST00000110289] [ENSMUST00000226626] [ENSMUST00000227505]
Predicted Effect probably null
Transcript: ENSMUST00000038856
SMART Domains Protein: ENSMUSP00000036320
Gene: ENSMUSG00000038760

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 177 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.6e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110289
SMART Domains Protein: ENSMUSP00000105918
Gene: ENSMUSG00000038760

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 175 1.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226626
Predicted Effect probably benign
Transcript: ENSMUST00000227505
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for thyrotropin-releasing hormone (TRH). Upon binding to TRH, this receptor activates the inositol phospholipid-calcium-protein kinase C transduction pathway. Mutations in this gene have been associated with generalized thyrotropin-releasing hormone resistance. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are fertile and display decreased thyroxine, triiodothyronine, and prolactin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Trhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Trhr APN 15 44229312 missense probably damaging 1.00
IGL01800:Trhr APN 15 44229207 missense possibly damaging 0.69
IGL01945:Trhr APN 15 44197144 missense probably damaging 0.99
IGL02608:Trhr APN 15 44197678 missense probably benign 0.08
IGL02825:Trhr APN 15 44229525 missense possibly damaging 0.62
pushover UTSW 15 44197627 missense probably damaging 1.00
P4717OSA:Trhr UTSW 15 44197435 missense probably damaging 0.97
R0007:Trhr UTSW 15 44229151 splice site probably benign
R0276:Trhr UTSW 15 44197086 start codon destroyed probably null 0.74
R0620:Trhr UTSW 15 44229500 missense probably benign 0.01
R1563:Trhr UTSW 15 44197101 missense probably benign 0.05
R1728:Trhr UTSW 15 44197153 missense probably damaging 1.00
R1729:Trhr UTSW 15 44197153 missense probably damaging 1.00
R2144:Trhr UTSW 15 44197183 missense probably benign 0.44
R2167:Trhr UTSW 15 44229242 missense probably damaging 1.00
R3965:Trhr UTSW 15 44197699 missense possibly damaging 0.70
R4272:Trhr UTSW 15 44197224 missense probably damaging 0.97
R4378:Trhr UTSW 15 44197627 missense probably damaging 1.00
R4618:Trhr UTSW 15 44197641 missense probably benign 0.00
R5093:Trhr UTSW 15 44197584 missense probably damaging 0.96
R5388:Trhr UTSW 15 44197477 missense possibly damaging 0.91
R5496:Trhr UTSW 15 44197536 missense probably benign 0.00
R6341:Trhr UTSW 15 44229298 nonsense probably null
R6463:Trhr UTSW 15 44197585 missense probably benign 0.09
R6575:Trhr UTSW 15 44229206 missense possibly damaging 0.83
R7483:Trhr UTSW 15 44229231 missense probably damaging 1.00
Y5406:Trhr UTSW 15 44197641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACAAGCTTCACTCAGAAACTAG -3'
(R):5'- GCACACCATAGGTTAAACTTGTC -3'

Sequencing Primer
(F):5'- AAGCTTCACTCAGAAACTAGAAAAG -3'
(R):5'- AACTTGTCACTTGATGTAGTCCG -3'
Posted On2015-06-12