Incidental Mutation 'R4247:Gtf3c5'
ID320450
Institutional Source Beutler Lab
Gene Symbol Gtf3c5
Ensembl Gene ENSMUSG00000026816
Gene Namegeneral transcription factor IIIC, polypeptide 5
SynonymsTFIIICepsilon, TFIIIC63, 2700084A09Rik, TFiiiC2-63
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28566311-28583751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28571184 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 306 (D306G)
Ref Sequence ENSEMBL: ENSMUSP00000109521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028157] [ENSMUST00000113889]
Predicted Effect probably damaging
Transcript: ENSMUST00000028157
AA Change: D306G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028157
Gene: ENSMUSG00000026816
AA Change: D306G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Tau95 23 322 2.8e-71 PFAM
coiled coil region 471 494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113889
AA Change: D306G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109521
Gene: ENSMUSG00000026816
AA Change: D306G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Tau95 24 322 1.7e-85 PFAM
coiled coil region 477 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177012
Meta Mutation Damage Score 0.9514 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Gtf3c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Gtf3c5 APN 2 28569289 splice site probably null
R0062:Gtf3c5 UTSW 2 28572186 splice site probably benign
R0062:Gtf3c5 UTSW 2 28572186 splice site probably benign
R0395:Gtf3c5 UTSW 2 28577918 missense probably damaging 1.00
R0653:Gtf3c5 UTSW 2 28577996 missense probably benign 0.34
R1232:Gtf3c5 UTSW 2 28571215 missense probably damaging 1.00
R1828:Gtf3c5 UTSW 2 28579682 missense probably damaging 1.00
R2174:Gtf3c5 UTSW 2 28567775 missense probably benign 0.26
R3154:Gtf3c5 UTSW 2 28579536 missense probably damaging 0.96
R4612:Gtf3c5 UTSW 2 28579584 missense probably benign 0.00
R4673:Gtf3c5 UTSW 2 28572224 missense probably benign 0.20
R5092:Gtf3c5 UTSW 2 28582873 missense possibly damaging 0.58
R6009:Gtf3c5 UTSW 2 28571165 missense probably benign 0.00
R6334:Gtf3c5 UTSW 2 28570462 missense probably benign 0.00
R6808:Gtf3c5 UTSW 2 28570487 missense probably damaging 0.98
R7490:Gtf3c5 UTSW 2 28571141 missense probably damaging 1.00
R7544:Gtf3c5 UTSW 2 28579542 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CACACATGTGCTGATACTCAAC -3'
(R):5'- AGGCACTGTTGGACTCCTTC -3'

Sequencing Primer
(F):5'- GTGCTGATACTCAACACACAGATAC -3'
(R):5'- GGACAGTTGTCACAGAAACTCCTG -3'
Posted On2015-06-12