Incidental Mutation 'R4247:Trp73'
ID320457
Institutional Source Beutler Lab
Gene Symbol Trp73
Ensembl Gene ENSMUSG00000029026
Gene Nametransformation related protein 73
SynonymsdeltaNp73, p73, TAp73
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154056253-154140208 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 154064632 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097762] [ENSMUST00000097762] [ENSMUST00000097763] [ENSMUST00000097763] [ENSMUST00000105643] [ENSMUST00000105643] [ENSMUST00000105644] [ENSMUST00000105644] [ENSMUST00000133533] [ENSMUST00000133533] [ENSMUST00000139634] [ENSMUST00000155642] [ENSMUST00000155642]
Predicted Effect probably null
Transcript: ENSMUST00000097762
SMART Domains Protein: ENSMUSP00000095368
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 2.6e-111 PFAM
Pfam:P53_tetramer 296 337 8.5e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Pfam:SAM_2 352 406 1.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097762
SMART Domains Protein: ENSMUSP00000095368
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 2.6e-111 PFAM
Pfam:P53_tetramer 296 337 8.5e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Pfam:SAM_2 352 406 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097763
SMART Domains Protein: ENSMUSP00000134196
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 6.4e-112 PFAM
Pfam:P53_tetramer 296 337 2.3e-21 PFAM
low complexity region 341 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097763
SMART Domains Protein: ENSMUSP00000134196
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 6.4e-112 PFAM
Pfam:P53_tetramer 296 337 2.3e-21 PFAM
low complexity region 341 362 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105643
SMART Domains Protein: ENSMUSP00000101268
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 2.1e-111 PFAM
Pfam:P53_tetramer 296 337 7.6e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105643
SMART Domains Protein: ENSMUSP00000101268
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 2.1e-111 PFAM
Pfam:P53_tetramer 296 337 7.6e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105644
SMART Domains Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 112 308 3.1e-115 PFAM
Pfam:P53_tetramer 344 383 8.3e-21 PFAM
low complexity region 390 398 N/A INTRINSIC
SAM 486 552 2.71e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105644
SMART Domains Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 112 308 3.1e-115 PFAM
Pfam:P53_tetramer 344 383 8.3e-21 PFAM
low complexity region 390 398 N/A INTRINSIC
SAM 486 552 2.71e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000133533
SMART Domains Protein: ENSMUSP00000114418
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 3.8e-111 PFAM
Pfam:P53_tetramer 296 337 1.1e-20 PFAM
low complexity region 342 350 N/A INTRINSIC
SAM 438 504 2.71e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000133533
SMART Domains Protein: ENSMUSP00000114418
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 3.8e-111 PFAM
Pfam:P53_tetramer 296 337 1.1e-20 PFAM
low complexity region 342 350 N/A INTRINSIC
SAM 438 504 2.71e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139634
SMART Domains Protein: ENSMUSP00000114736
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:P53 152 204 3.1e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155642
SMART Domains Protein: ENSMUSP00000135281
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 42 213 1.3e-94 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155642
SMART Domains Protein: ENSMUSP00000135281
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 42 213 1.3e-94 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes tumor protein p73, which is a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include p53, p63, and p73 and have high sequence similarity to one another, which allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways involving direct or indirect protein interactions, resulting in regulation of the same target gene promoters or regulation of each other's promoters. The p73 protein is expressed at very low levels in normal tissues and is differentially expressed in a number of tumors. The p73 gene expresses at least 35 mRNA variants due to the use of alternate promoters, alternate translation initiation sites, and multiple splice variations. Theoretically this can account for 29 different p73 isoforms; however, the biological validity and the full-length nature of most variants have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display a variety of defects including hippocampal dysgenesis, hydrocephalus, chronic infections and inflammation, abnormal pheromone sensory pathways, eye abnormalities, impaired growth, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Trp73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Trp73 APN 4 154081486 missense possibly damaging 0.82
IGL02264:Trp73 APN 4 154064428 missense probably null 0.98
IGL02344:Trp73 APN 4 154062043 missense possibly damaging 0.92
IGL02663:Trp73 APN 4 154062506 splice site probably null
IGL02956:Trp73 APN 4 154064463 splice site probably benign
IGL03093:Trp73 APN 4 154104873 missense probably benign 0.00
slowpoke UTSW 4 154064632 splice site probably null
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0363:Trp73 UTSW 4 154063949 missense probably benign 0.17
R0409:Trp73 UTSW 4 154064384 missense possibly damaging 0.81
R1161:Trp73 UTSW 4 154081323 splice site probably null
R1531:Trp73 UTSW 4 154063895 missense probably benign 0.31
R2002:Trp73 UTSW 4 154081445 missense probably damaging 1.00
R2185:Trp73 UTSW 4 154104817 critical splice donor site probably null
R3965:Trp73 UTSW 4 154062036 missense probably benign 0.03
R3966:Trp73 UTSW 4 154062036 missense probably benign 0.03
R4595:Trp73 UTSW 4 154064417 missense probably damaging 0.99
R5170:Trp73 UTSW 4 154104838 missense possibly damaging 0.95
R5260:Trp73 UTSW 4 154062602 missense possibly damaging 0.48
R5622:Trp73 UTSW 4 154060592 missense possibly damaging 0.68
R6173:Trp73 UTSW 4 154104341 missense probably damaging 1.00
R6252:Trp73 UTSW 4 154064397 missense probably damaging 1.00
R6950:Trp73 UTSW 4 154062053 missense probably benign 0.18
R7043:Trp73 UTSW 4 154067007 splice site probably null
R7050:Trp73 UTSW 4 154081442 missense probably damaging 1.00
R7052:Trp73 UTSW 4 154064683 missense probably damaging 0.98
R7620:Trp73 UTSW 4 154059257 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGATGCGACCCTCGAAAG -3'
(R):5'- TTTTCTTAGAAGGTGGGCCC -3'

Sequencing Primer
(F):5'- GACCTGTCCACTGTTGGGTC -3'
(R):5'- CTGCATGCTGACTGATACTAAGC -3'
Posted On2015-06-12