Incidental Mutation 'R4247:Ccdc97'
ID320465
Institutional Source Beutler Lab
Gene Symbol Ccdc97
Ensembl Gene ENSMUSG00000002608
Gene Namecoiled-coil domain containing 97
Synonyms1200014H14Rik, D7Ertd462e, 2810446P04Rik
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4247 (G1)
Quality Score198
Status Validated
Chromosome7
Chromosomal Location25711106-25719088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25716034 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 68 (H68P)
Ref Sequence ENSEMBL: ENSMUSP00000002683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002683] [ENSMUST00000125699]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002683
AA Change: H68P

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002683
Gene: ENSMUSG00000002608
AA Change: H68P

DomainStartEndE-ValueType
Pfam:DUF2052 156 327 4.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125699
AA Change: H3P

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156365
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Ccdc97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Ccdc97 APN 7 25714852 missense probably damaging 1.00
R0058:Ccdc97 UTSW 7 25715980 missense probably benign 0.16
R0369:Ccdc97 UTSW 7 25714408 missense probably damaging 0.97
R0617:Ccdc97 UTSW 7 25714420 missense probably damaging 1.00
R3845:Ccdc97 UTSW 7 25715028 splice site probably benign
R4747:Ccdc97 UTSW 7 25718923 unclassified probably null
R5298:Ccdc97 UTSW 7 25716007 missense probably damaging 1.00
R5310:Ccdc97 UTSW 7 25715776 missense probably damaging 1.00
R6189:Ccdc97 UTSW 7 25716098 missense probably benign 0.02
R6812:Ccdc97 UTSW 7 25713044 missense probably damaging 0.99
R6971:Ccdc97 UTSW 7 25714959 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTAGAAATCAGCACGGTGGTC -3'
(R):5'- CTTCCCCTGATGCCCTTAACTAAAG -3'

Sequencing Primer
(F):5'- TGGTCTCCACGCAGATGG -3'
(R):5'- TAAAGACTCCTCTTGACTCTCAGACG -3'
Posted On2015-06-12