Incidental Mutation 'R4247:Olfr690'
ID320468
Institutional Source Beutler Lab
Gene Symbol Olfr690
Ensembl Gene ENSMUSG00000050266
Gene Nameolfactory receptor 690
SynonymsGA_x6K02T2PBJ9-7959171-7958224, MOR31-2
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105328225-105334104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105330148 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 15 (I15V)
Ref Sequence ENSEMBL: ENSMUSP00000150831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061920] [ENSMUST00000211006] [ENSMUST00000216230]
Predicted Effect probably benign
Transcript: ENSMUST00000061920
AA Change: I15V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061272
Gene: ENSMUSG00000050266
AA Change: I15V

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:7tm_4 33 312 2e-110 PFAM
Pfam:7TM_GPCR_Srsx 37 264 1.4e-9 PFAM
Pfam:7tm_1 43 294 1.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209868
Predicted Effect probably benign
Transcript: ENSMUST00000211006
AA Change: I15V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216230
AA Change: I15V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Olfr690
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Olfr690 APN 7 105329382 missense possibly damaging 0.95
IGL01403:Olfr690 APN 7 105329398 missense probably benign 0.01
IGL01546:Olfr690 APN 7 105329692 missense probably damaging 1.00
IGL02936:Olfr690 APN 7 105330005 nonsense probably null
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R0206:Olfr690 UTSW 7 105329883 missense possibly damaging 0.76
R1425:Olfr690 UTSW 7 105329715 missense probably damaging 1.00
R1911:Olfr690 UTSW 7 105329383 missense probably benign 0.11
R2126:Olfr690 UTSW 7 105329252 nonsense probably null
R2511:Olfr690 UTSW 7 105329610 missense probably damaging 1.00
R2919:Olfr690 UTSW 7 105329860 missense probably damaging 1.00
R3755:Olfr690 UTSW 7 105330151 missense probably damaging 1.00
R4152:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4153:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R4154:Olfr690 UTSW 7 105329385 missense probably damaging 1.00
R5015:Olfr690 UTSW 7 105329604 missense possibly damaging 0.61
R5143:Olfr690 UTSW 7 105329524 missense probably damaging 1.00
R5642:Olfr690 UTSW 7 105329565 missense probably damaging 1.00
R6747:Olfr690 UTSW 7 105330027 missense probably benign 0.00
R6961:Olfr690 UTSW 7 105329706 missense probably damaging 1.00
R7074:Olfr690 UTSW 7 105329268 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TAGGCACAGTGGTGGTTGAC -3'
(R):5'- GTTTGTATCTGCAGTGCTAACG -3'

Sequencing Primer
(F):5'- CAGGAGAATATCAGTGCCAGCC -3'
(R):5'- CTGCAGTGCTAACGTGGGAAATG -3'
Posted On2015-06-12