Incidental Mutation 'R0396:Kmt2b'
ID 32047
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Name lysine (K)-specific methyltransferase 2B
Synonyms 2610014H22Rik, Wbp7, Mll2
MMRRC Submission 038602-MU
Accession Numbers

Genbank: NM_029274; MGI: 109565

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0396 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 30568858-30588726 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30576755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1773 (T1773K)
Ref Sequence ENSEMBL: ENSMUSP00000103789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108154]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000006470
AA Change: T1773K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: T1773K

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108154
AA Change: T1773K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: T1773K

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128456
Predicted Effect unknown
Transcript: ENSMUST00000131002
AA Change: T1064K
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307
AA Change: T1064K

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152931
Meta Mutation Damage Score 0.4644 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,377 V467A possibly damaging Het
4933405L10Rik G A 8: 105,709,780 V194I probably benign Het
Acsm1 A T 7: 119,636,455 I133F probably damaging Het
Adamts9 T A 6: 92,798,005 T1676S probably benign Het
Adcy4 T C 14: 55,772,288 D769G probably benign Het
Aif1 T C 17: 35,171,109 *148W probably null Het
Akna C T 4: 63,392,126 probably benign Het
Arhgap32 G A 9: 32,245,255 probably null Het
Atpaf1 G A 4: 115,785,252 E92K possibly damaging Het
C1s1 T C 6: 124,533,354 E378G probably benign Het
Caprin1 T A 2: 103,769,569 Q108L probably damaging Het
Car13 A T 3: 14,656,239 H154L probably benign Het
Cdon C A 9: 35,470,130 N605K probably damaging Het
Ceacam10 G A 7: 24,781,014 G70E probably damaging Het
Cfap221 G A 1: 119,954,200 T286M probably benign Het
Cfap61 T C 2: 145,949,944 F107S possibly damaging Het
Coil C A 11: 88,981,623 T270N probably benign Het
Crocc2 T G 1: 93,224,214 probably benign Het
Crot T C 5: 8,969,959 E461G probably damaging Het
D130052B06Rik G T 11: 33,623,391 R41L unknown Het
D630045J12Rik T C 6: 38,196,736 S166G possibly damaging Het
Dennd4a T G 9: 64,862,391 V460G probably damaging Het
Depdc7 A T 2: 104,727,323 probably benign Het
Dgkb G A 12: 38,190,135 probably null Het
Dhx57 T G 17: 80,274,797 S407R probably benign Het
Dnase2a G T 8: 84,909,763 probably benign Het
Dqx1 T G 6: 83,059,005 M106R probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Ephx2 T G 14: 66,108,063 I151L probably benign Het
Gdf3 C T 6: 122,607,135 G91D probably damaging Het
Gm14124 G A 2: 150,268,053 G221D probably damaging Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gsdme T A 6: 50,221,107 H291L probably benign Het
H2-Bl A G 17: 36,083,722 I103T possibly damaging Het
Hif3a G A 7: 17,052,021 probably benign Het
Hmox2 A T 16: 4,765,763 I232L probably benign Het
Itgb2 A G 10: 77,561,189 Y686C probably damaging Het
Jmjd1c A G 10: 67,219,523 T528A possibly damaging Het
Kdr T C 5: 75,960,728 I541V possibly damaging Het
Khdrbs2 C A 1: 32,519,973 V343L probably damaging Het
Kif16b C T 2: 142,853,659 R175H probably damaging Het
Klri2 T G 6: 129,740,288 E44A possibly damaging Het
Lair1 A G 7: 4,010,786 L154P probably damaging Het
Larp1b G A 3: 40,970,561 V158M probably damaging Het
Lgi3 T A 14: 70,534,840 I275N probably damaging Het
Lrba A G 3: 86,295,179 N246D probably damaging Het
Lrrc45 T A 11: 120,714,907 probably benign Het
Mdh2 G T 5: 135,789,679 V263L probably benign Het
Myom1 T A 17: 71,034,693 V149E probably damaging Het
Nanos1 A T 19: 60,757,041 D259V probably damaging Het
Nedd4l T A 18: 65,161,654 probably benign Het
Npas3 A G 12: 53,831,745 Y150C probably damaging Het
Olfr1066 T C 2: 86,456,019 N84S possibly damaging Het
Olfr1129 T A 2: 87,575,567 V161D possibly damaging Het
Olfr1392 A T 11: 49,293,338 I6F probably benign Het
Olfr479 A T 7: 108,055,963 H327L probably benign Het
Olfr672 G A 7: 104,996,706 A66V probably damaging Het
Olfr93 C T 17: 37,151,555 C139Y probably damaging Het
Pde4c A G 8: 70,750,076 N637S probably benign Het
Pds5b T A 5: 150,779,275 V824D possibly damaging Het
Pole2 A T 12: 69,222,386 probably benign Het
Ppig C T 2: 69,735,976 probably benign Het
Prep A G 10: 45,092,676 Y90C probably damaging Het
Proca1 A T 11: 78,194,905 R11S probably damaging Het
Prph T A 15: 99,056,991 W313R probably benign Het
Prune2 C T 19: 17,123,080 P1983S probably benign Het
Ptbp2 G A 3: 119,724,198 probably benign Het
Rsph6a C T 7: 19,074,106 P398L probably damaging Het
Sdk2 T C 11: 113,829,967 I1379V probably benign Het
Sf3b1 C T 1: 55,019,271 G53E probably damaging Het
Slc9a3 T C 13: 74,157,784 probably null Het
Smarcal1 A T 1: 72,626,473 H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,150,707 probably benign Het
Sptan1 T C 2: 29,991,033 V438A probably damaging Het
Sstr4 T A 2: 148,396,261 V264D probably damaging Het
Susd2 A G 10: 75,639,911 L418P probably damaging Het
Synj1 A G 16: 90,938,640 V1475A probably benign Het
Szt2 G A 4: 118,376,347 probably benign Het
Tbc1d4 T C 14: 101,458,063 probably null Het
Tesk1 A G 4: 43,446,000 E311G probably damaging Het
Tmed5 A T 5: 108,126,016 V119E probably damaging Het
Tmem260 T C 14: 48,486,867 S201P possibly damaging Het
Tnxb A G 17: 34,671,733 Y350C probably damaging Het
Tpte T C 8: 22,335,608 probably benign Het
Trim37 A T 11: 87,146,968 D161V probably damaging Het
Trrap C A 5: 144,814,556 Q1640K probably damaging Het
Tspoap1 T C 11: 87,776,346 probably benign Het
Ttk T A 9: 83,847,260 probably benign Het
Vmn1r172 A G 7: 23,660,532 S281G probably benign Het
Vmn1r177 A G 7: 23,865,597 S285P probably damaging Het
Vmn1r231 C T 17: 20,890,399 V85I probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r118 T C 17: 55,608,643 I436V probably benign Het
Vmn2r12 T C 5: 109,092,899 K116R probably benign Het
Vmn2r28 T A 7: 5,488,514 I245L probably benign Het
Wdr26 A T 1: 181,180,651 probably benign Het
Xrcc3 A T 12: 111,809,957 H67Q probably benign Het
Zbbx A T 3: 75,078,495 S417T possibly damaging Het
Zc3h13 A G 14: 75,323,482 D504G unknown Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zyg11b A T 4: 108,255,308 F388I probably damaging Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30586513 unclassified probably benign
IGL00821:Kmt2b APN 7 30570613 missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30579927 missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30580507 missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30569514 critical splice donor site probably null
IGL01949:Kmt2b APN 7 30577161 splice site probably null
IGL02253:Kmt2b APN 7 30581727 missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30578878 critical splice donor site probably null
IGL02493:Kmt2b APN 7 30569511 unclassified probably benign
IGL02504:Kmt2b APN 7 30586543 unclassified probably benign
IGL02532:Kmt2b APN 7 30586889 unclassified probably benign
IGL02698:Kmt2b APN 7 30578693 splice site probably benign
IGL02717:Kmt2b APN 7 30583444 missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30577144 missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30575462 missense probably benign 0.02
IGL03386:Kmt2b APN 7 30573971 missense possibly damaging 0.94
Dean UTSW 7 30569410 missense possibly damaging 0.83
provost UTSW 7 30582208 missense probably damaging 1.00
tenure UTSW 7 30569175 missense probably damaging 1.00
3-1:Kmt2b UTSW 7 30569615 nonsense probably null
FR4304:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4342:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4548:Kmt2b UTSW 7 30586380 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586364 nonsense probably null
FR4589:Kmt2b UTSW 7 30586381 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586367 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586370 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586378 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586360 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586362 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586364 nonsense probably null
FR4976:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586373 unclassified probably benign
PIT4403001:Kmt2b UTSW 7 30585689 missense probably damaging 1.00
PIT4802001:Kmt2b UTSW 7 30579571 missense probably damaging 0.99
R0057:Kmt2b UTSW 7 30576792 splice site probably benign
R0131:Kmt2b UTSW 7 30583921 missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30574193 missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30574940 missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30580487 missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30576960 splice site probably benign
R1599:Kmt2b UTSW 7 30570575 missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30583962 missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30585850 missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30574658 missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30575351 missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30569420 missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30583387 missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30574065 missense probably benign 0.25
R2401:Kmt2b UTSW 7 30576708 missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30576068 missense probably benign 0.10
R3436:Kmt2b UTSW 7 30576692 missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30574064 missense probably benign 0.25
R4259:Kmt2b UTSW 7 30581081 missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30581836 critical splice donor site probably null
R4388:Kmt2b UTSW 7 30588590 unclassified probably benign
R4542:Kmt2b UTSW 7 30580259 missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30586358 unclassified probably benign
R4722:Kmt2b UTSW 7 30583202 missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30576761 nonsense probably null
R4916:Kmt2b UTSW 7 30578517 missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30569840 missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30569175 missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30569794 missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30581673 missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30580444 missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30577145 missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30588477 unclassified probably benign
R6727:Kmt2b UTSW 7 30584559 missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30586276 unclassified probably benign
R7048:Kmt2b UTSW 7 30569306 missense probably damaging 0.99
R7155:Kmt2b UTSW 7 30579963 missense probably damaging 0.99
R7307:Kmt2b UTSW 7 30580471 missense probably damaging 0.99
R7388:Kmt2b UTSW 7 30581960 missense probably damaging 1.00
R7555:Kmt2b UTSW 7 30569410 missense possibly damaging 0.83
R7569:Kmt2b UTSW 7 30569553 missense possibly damaging 0.54
R7616:Kmt2b UTSW 7 30582208 missense probably damaging 1.00
R7669:Kmt2b UTSW 7 30583231 missense possibly damaging 0.84
R7881:Kmt2b UTSW 7 30579783 missense probably damaging 1.00
R7999:Kmt2b UTSW 7 30576774 missense probably damaging 1.00
R8003:Kmt2b UTSW 7 30569377 missense probably damaging 0.98
R8189:Kmt2b UTSW 7 30569331 missense probably damaging 0.98
R8291:Kmt2b UTSW 7 30585469 missense probably damaging 1.00
R8314:Kmt2b UTSW 7 30578922 missense probably damaging 0.99
R8802:Kmt2b UTSW 7 30584071 missense probably damaging 1.00
R8954:Kmt2b UTSW 7 30574215 missense probably damaging 1.00
R9046:Kmt2b UTSW 7 30586054 missense probably benign 0.00
R9225:Kmt2b UTSW 7 30586747 missense unknown
R9258:Kmt2b UTSW 7 30582468 missense probably null 0.99
R9414:Kmt2b UTSW 7 30582882 missense probably damaging 0.99
RF001:Kmt2b UTSW 7 30586382 unclassified probably benign
RF006:Kmt2b UTSW 7 30586377 unclassified probably benign
RF020:Kmt2b UTSW 7 30586382 unclassified probably benign
RF021:Kmt2b UTSW 7 30586357 unclassified probably benign
RF030:Kmt2b UTSW 7 30586377 unclassified probably benign
RF035:Kmt2b UTSW 7 30586357 unclassified probably benign
X0067:Kmt2b UTSW 7 30579573 missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30585251 missense probably benign 0.28
Z1176:Kmt2b UTSW 7 30577370 missense probably damaging 1.00
Z1177:Kmt2b UTSW 7 30575024 missense probably benign 0.08
Z1177:Kmt2b UTSW 7 30584163 missense probably damaging 0.98
Z1177:Kmt2b UTSW 7 30586416 missense unknown
Z1186:Kmt2b UTSW 7 30574979 missense probably benign
Z1186:Kmt2b UTSW 7 30585307 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGCTACCTACCTGAGGAAGGG -3'
(R):5'- CGAGGGCATCAACTTCAAGCGAAAG -3'

Sequencing Primer
(F):5'- AAGGGGTTGGGCTATGCAC -3'
(R):5'- CTTGACTGGACTTGAACCAGATG -3'
Posted On 2013-04-24