Incidental Mutation 'R4247:Upp1'
ID320474
Institutional Source Beutler Lab
Gene Symbol Upp1
Ensembl Gene ENSMUSG00000020407
Gene Nameuridine phosphorylase 1
SynonymsUPase, UdRPase, Up
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location9118103-9136170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9134815 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 178 (I178T)
Ref Sequence ENSEMBL: ENSMUSP00000127473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020677] [ENSMUST00000101525] [ENSMUST00000130522] [ENSMUST00000164791] [ENSMUST00000170444] [ENSMUST00000172452]
Predicted Effect probably benign
Transcript: ENSMUST00000020677
AA Change: I178T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020677
Gene: ENSMUSG00000020407
AA Change: I178T

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 55 305 1.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101525
AA Change: I178T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099063
Gene: ENSMUSG00000020407
AA Change: I178T

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 55 305 1.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130522
SMART Domains Protein: ENSMUSP00000123285
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
PDB:3NBQ|D 1 137 9e-76 PDB
SCOP:d1k9sa_ 43 127 1e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146696
Predicted Effect probably benign
Transcript: ENSMUST00000164791
AA Change: I178T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127473
Gene: ENSMUSG00000020407
AA Change: I178T

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 55 305 1.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166455
SMART Domains Protein: ENSMUSP00000129276
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 45 143 6.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170444
SMART Domains Protein: ENSMUSP00000125934
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 55 149 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172452
SMART Domains Protein: ENSMUSP00000129787
Gene: ENSMUSG00000020407

DomainStartEndE-ValueType
PDB:3NBQ|D 1 114 4e-60 PDB
SCOP:d1lx7a_ 35 114 7e-10 SMART
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine phosphorylase, an enzyme that catalyzes the reversible phosphorylation of uridine (or 2'- deoxyuridine) to uracil and ribose-1-phosphate (or deoxyribose-1-phosphate). The encoded enzyme functions in the degradation and salvage of pyrimidine ribonucleosides. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a targeted disruption have increased uridine concentration in tissues, urine and blood, along with disorders of various nucleotide metabolisms and decreased sensitivity to pentobarbital and 5-fluorouracil. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Upp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Upp1 APN 11 9136100 makesense probably null
IGL01870:Upp1 APN 11 9125700 critical splice donor site probably null
IGL02125:Upp1 APN 11 9125650 utr 5 prime probably benign
R0373:Upp1 UTSW 11 9129590 missense probably benign 0.01
R1501:Upp1 UTSW 11 9134708 splice site probably null
R1617:Upp1 UTSW 11 9134865 missense probably damaging 0.99
R1980:Upp1 UTSW 11 9134872 missense possibly damaging 0.67
R2018:Upp1 UTSW 11 9133240 missense possibly damaging 0.94
R2019:Upp1 UTSW 11 9133240 missense possibly damaging 0.94
R2214:Upp1 UTSW 11 9136033 missense probably benign
R3425:Upp1 UTSW 11 9125700 critical splice donor site probably null
R4063:Upp1 UTSW 11 9131709 missense probably damaging 1.00
R4776:Upp1 UTSW 11 9135976 missense probably damaging 0.98
R5160:Upp1 UTSW 11 9135193 missense possibly damaging 0.68
R5500:Upp1 UTSW 11 9131774 missense probably damaging 1.00
R5514:Upp1 UTSW 11 9131771 missense probably damaging 1.00
R5677:Upp1 UTSW 11 9136025 missense probably benign
R6825:Upp1 UTSW 11 9131707 missense probably benign
R7325:Upp1 UTSW 11 9134743 missense probably damaging 0.98
X0022:Upp1 UTSW 11 9125681 missense probably benign 0.00
X0022:Upp1 UTSW 11 9125682 missense possibly damaging 0.53
X0027:Upp1 UTSW 11 9134857 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTCAGTACTTGGCTTTG -3'
(R):5'- GGTCAGCACTCCAACAGAGATAG -3'

Sequencing Primer
(F):5'- GGCTTTGCCGATGGATCC -3'
(R):5'- ATCGCACAGCACGCTTG -3'
Posted On2015-06-12