Incidental Mutation 'R4247:Lrrc24'
ID320480
Institutional Source Beutler Lab
Gene Symbol Lrrc24
Ensembl Gene ENSMUSG00000033707
Gene Nameleucine rich repeat containing 24
Synonyms
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76715276-76722173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76717976 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 193 (I193T)
Ref Sequence ENSEMBL: ENSMUSP00000061906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036247] [ENSMUST00000036423] [ENSMUST00000049956] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155735] [ENSMUST00000228990]
Predicted Effect probably benign
Transcript: ENSMUST00000036247
SMART Domains Protein: ENSMUSP00000039910
Gene: ENSMUSG00000116138

DomainStartEndE-ValueType
Pfam:DUF4505 31 209 5.4e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036423
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000049956
AA Change: I193T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061906
Gene: ENSMUSG00000033707
AA Change: I193T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 30 62 1.04e-2 SMART
LRR 61 80 3.18e2 SMART
LRR_TYP 81 104 2.99e-4 SMART
LRR 106 128 3.87e1 SMART
LRR_TYP 129 152 8.22e-2 SMART
LRR_TYP 153 176 5.06e-2 SMART
LRR 177 200 2.02e-1 SMART
LRRCT 212 266 2e-10 SMART
IGc2 280 360 1.02e-9 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127208
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142506
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154531
Predicted Effect probably benign
Transcript: ENSMUST00000155735
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231059
Meta Mutation Damage Score 0.7713 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Lrrc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Lrrc24 APN 15 76718063 missense probably damaging 1.00
IGL01556:Lrrc24 APN 15 76722575 missense probably damaging 0.99
IGL01940:Lrrc24 APN 15 76716057 missense probably damaging 1.00
IGL01966:Lrrc24 APN 15 76718311 missense probably benign 0.22
IGL02315:Lrrc24 APN 15 76718306 missense probably damaging 1.00
IGL03062:Lrrc24 APN 15 76718304 missense probably benign
R0240:Lrrc24 UTSW 15 76723209 missense probably damaging 1.00
R0240:Lrrc24 UTSW 15 76723209 missense probably damaging 1.00
R0365:Lrrc24 UTSW 15 76715784 missense probably benign 0.14
R1430:Lrrc24 UTSW 15 76723792 unclassified probably null
R1789:Lrrc24 UTSW 15 76722578 missense probably benign 0.02
R2131:Lrrc24 UTSW 15 76715581 missense possibly damaging 0.92
R2202:Lrrc24 UTSW 15 76722911 missense probably damaging 1.00
R4585:Lrrc24 UTSW 15 76723689 missense probably damaging 1.00
R4944:Lrrc24 UTSW 15 76718346 missense probably damaging 1.00
R4976:Lrrc24 UTSW 15 76716000 missense probably benign 0.00
R5119:Lrrc24 UTSW 15 76716000 missense probably benign 0.00
R5445:Lrrc24 UTSW 15 76716106 missense probably benign 0.10
R5772:Lrrc24 UTSW 15 76722710 missense probably damaging 1.00
R7795:Lrrc24 UTSW 15 76718048 missense probably benign 0.43
X0028:Lrrc24 UTSW 15 76715913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTGATGTAGCCACAGTGTG -3'
(R):5'- TGCTGCGATATCCCAACTGC -3'

Sequencing Primer
(F):5'- CACAGTGTGGATCTGCCTCTG -3'
(R):5'- CCCTGCTGCTAGGAGAGGTTAG -3'
Posted On2015-06-12