Incidental Mutation 'R4248:Lama5'
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Namelaminin, alpha 5
MMRRC Submission 041064-MU
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4248 (G1)
Quality Score225
Status Validated
Chromosomal Location180176373-180225859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 180180427 bp
Amino Acid Change Arginine to Glutamine at position 2896 (R2896Q)
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]
PDB Structure
Predicted Effect possibly damaging
Transcript: ENSMUST00000015791
AA Change: R2896Q

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: R2896Q

signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061437
SMART Domains Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

Pfam:Proteasom_Rpn13 29 111 3.5e-35 PFAM
low complexity region 135 161 N/A INTRINSIC
low complexity region 173 254 N/A INTRINSIC
Pfam:RPN13_C 268 381 7.3e-38 PFAM
low complexity region 390 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185089
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Alox12b G A 11: 69,163,605 V250I probably benign Het
Armt1 T C 10: 4,439,687 F115L probably benign Het
Cdh9 T C 15: 16,850,388 F536L probably benign Het
Fbxo25 T C 8: 13,939,617 S355P probably damaging Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gapt C A 13: 110,353,755 V125F probably damaging Het
Gucd1 A T 10: 75,509,828 V131E probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hivep2 A G 10: 14,131,555 E1299G probably damaging Het
Hnf4g A G 3: 3,652,849 D342G possibly damaging Het
Kmt2b C T 7: 30,574,064 R2349H probably benign Het
Moxd2 A C 6: 40,878,999 I552S probably damaging Het
Nkx1-2 TGGTGAGAGGGGGCCGCCTTGGCCCCG TG 7: 132,599,480 probably null Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Onecut3 A G 10: 80,514,129 T486A possibly damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pirb A G 7: 3,719,298 F182S probably damaging Het
Rev1 C T 1: 38,107,648 R34H possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Tep1 T C 14: 50,862,894 H389R possibly damaging Het
Tnfrsf1b G A 4: 145,215,965 A416V probably benign Het
Ust A T 10: 8,518,218 L61Q possibly damaging Het
Vmn2r101 A T 17: 19,589,114 K168N probably damaging Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 180189445 missense possibly damaging 0.89
R0003:Lama5 UTSW 2 180178079 unclassified probably null
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1078:Lama5 UTSW 2 180179764 unclassified probably benign
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1674:Lama5 UTSW 2 180201987 missense probably benign 0.00
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1696:Lama5 UTSW 2 180202486 missense probably damaging 1.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R1966:Lama5 UTSW 2 180188352 missense probably damaging 1.00
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4677:Lama5 UTSW 2 180179366 missense possibly damaging 0.69
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4923:Lama5 UTSW 2 180184149 missense probably benign 0.18
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5061:Lama5 UTSW 2 180198786 nonsense probably null
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R7022:Lama5 UTSW 2 180180731 missense probably damaging 1.00
R7204:Lama5 UTSW 2 180202177 missense probably damaging 1.00
R7207:Lama5 UTSW 2 180207084 missense probably damaging 0.98
R7282:Lama5 UTSW 2 180201795 missense probably damaging 1.00
R7367:Lama5 UTSW 2 180192958 missense probably benign 0.01
R7410:Lama5 UTSW 2 180202390 critical splice donor site probably null
R7849:Lama5 UTSW 2 180201812 missense probably damaging 1.00
R7909:Lama5 UTSW 2 180192276 missense possibly damaging 0.95
R7932:Lama5 UTSW 2 180201812 missense probably damaging 1.00
R7948:Lama5 UTSW 2 180202201 missense probably damaging 1.00
R7990:Lama5 UTSW 2 180192276 missense possibly damaging 0.95
RF020:Lama5 UTSW 2 180196178 missense probably benign
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Z1177:Lama5 UTSW 2 180183630 missense probably benign 0.03
Z1177:Lama5 UTSW 2 180189419 missense probably damaging 1.00
Z1177:Lama5 UTSW 2 180190714 missense possibly damaging 0.95
Z1177:Lama5 UTSW 2 180198810 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-12