Incidental Mutation 'R4248:Fbxo25'
ID320496
Institutional Source Beutler Lab
Gene Symbol Fbxo25
Ensembl Gene ENSMUSG00000038365
Gene NameF-box protein 25
Synonyms9130015I06Rik, Fbx25
MMRRC Submission 041064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R4248 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13907803-13940522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13939617 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 355 (S355P)
Ref Sequence ENSEMBL: ENSMUSP00000147467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043520] [ENSMUST00000209913]
Predicted Effect probably damaging
Transcript: ENSMUST00000043520
AA Change: S347P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039544
Gene: ENSMUSG00000038365
AA Change: S347P

DomainStartEndE-ValueType
low complexity region 209 222 N/A INTRINSIC
Blast:FBOX 230 271 1e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209310
Predicted Effect probably damaging
Transcript: ENSMUST00000209913
AA Change: S355P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210280
Meta Mutation Damage Score 0.4547 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Alox12b G A 11: 69,163,605 V250I probably benign Het
Armt1 T C 10: 4,439,687 F115L probably benign Het
Cdh9 T C 15: 16,850,388 F536L probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gapt C A 13: 110,353,755 V125F probably damaging Het
Gucd1 A T 10: 75,509,828 V131E probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hivep2 A G 10: 14,131,555 E1299G probably damaging Het
Hnf4g A G 3: 3,652,849 D342G possibly damaging Het
Kmt2b C T 7: 30,574,064 R2349H probably benign Het
Lama5 C T 2: 180,180,427 R2896Q possibly damaging Het
Moxd2 A C 6: 40,878,999 I552S probably damaging Het
Nkx1-2 TGGTGAGAGGGGGCCGCCTTGGCCCCG TG 7: 132,599,480 probably null Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Onecut3 A G 10: 80,514,129 T486A possibly damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pirb A G 7: 3,719,298 F182S probably damaging Het
Rev1 C T 1: 38,107,648 R34H possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Tep1 T C 14: 50,862,894 H389R possibly damaging Het
Tnfrsf1b G A 4: 145,215,965 A416V probably benign Het
Ust A T 10: 8,518,218 L61Q possibly damaging Het
Vmn2r101 A T 17: 19,589,114 K168N probably damaging Het
Other mutations in Fbxo25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Fbxo25 APN 8 13923922 unclassified probably benign
IGL03087:Fbxo25 APN 8 13924019 critical splice donor site probably null
IGL03112:Fbxo25 APN 8 13921034 missense probably benign 0.18
IGL03403:Fbxo25 APN 8 13929423 missense probably benign 0.00
R0720:Fbxo25 UTSW 8 13935222 missense probably damaging 1.00
R0755:Fbxo25 UTSW 8 13935219 missense probably benign 0.00
R1865:Fbxo25 UTSW 8 13935248 missense probably damaging 1.00
R2043:Fbxo25 UTSW 8 13921905 missense probably damaging 0.99
R4213:Fbxo25 UTSW 8 13939581 missense probably damaging 1.00
R5380:Fbxo25 UTSW 8 13921886 missense probably benign 0.10
R7450:Fbxo25 UTSW 8 13931235 missense probably benign 0.09
R8264:Fbxo25 UTSW 8 13929393 missense possibly damaging 0.89
R8409:Fbxo25 UTSW 8 13914999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCACCTGTTAATAGATGTGCTTG -3'
(R):5'- TTCTCCAAGGAGCAAGCGAG -3'

Sequencing Primer
(F):5'- AATAGATGTGCTTGGGGCCACC -3'
(R):5'- CGAGGGTTGCACAGGTAC -3'
Posted On2015-06-12